Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0313966137:

Variant ID: vg0313966137 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 13966137
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

GACATATATATAGGGGTGGGACTTTAGTCCCAGTTGGTAGCACCAACCGGGGCTAAAGATCACAAGGATCTTTAGCCCCGGTTGGTATTACCAACCGGGA[C/T]
TAAAGTTACGATTTTTAGTCCCGGTTGGTAATCCCGGGGGGGCCTGACATGCCCTGACAGCATTCGAACCGAGATTAAAGATGATCTTTAGTTGTTACCA

Reverse complement sequence

TGGTAACAACTAAAGATCATCTTTAATCTCGGTTCGAATGCTGTCAGGGCATGTCAGGCCCCCCCGGGATTACCAACCGGGACTAAAAATCGTAACTTTA[G/A]
TCCCGGTTGGTAATACCAACCGGGGCTAAAGATCCTTGTGATCTTTAGCCCCGGTTGGTGCTACCAACTGGGACTAAAGTCCCACCCCTATATATATGTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.40%	2.00%	30.41%	10.26%	NA
All Indica	2759	29.90%	3.30%	49.58%	17.22%	NA
All Japonica	1512	99.50%	0.00%	0.13%	0.33%	NA
Aus	269	84.40%	0.40%	14.87%	0.37%	NA
Indica I	595	20.70%	2.20%	57.82%	19.33%	NA
Indica II	465	35.90%	1.30%	37.20%	25.59%	NA
Indica III	913	35.70%	5.50%	50.05%	8.76%	NA
Indica Intermediate	786	26.50%	2.90%	50.13%	20.48%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	99.40%	0.00%	0.40%	0.20%	NA
Japonica Intermediate	241	99.20%	0.00%	0.00%	0.83%	NA
VI/Aromatic	96	94.80%	0.00%	5.21%	0.00%	NA
Intermediate	90	71.10%	0.00%	24.44%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0313966137	C -> T	LOC_Os03g24490.1	upstream_gene_variant ; 1060.0bp to feature; MODIFIER	silent_mutation	Average:21.842; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0313966137	C -> T	LOC_Os03g24500.1	upstream_gene_variant ; 549.0bp to feature; MODIFIER	silent_mutation	Average:21.842; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0313966137	C -> T	LOC_Os03g24510.1	upstream_gene_variant ; 3974.0bp to feature; MODIFIER	silent_mutation	Average:21.842; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0313966137	C -> T	LOC_Os03g24490-LOC_Os03g24500	intergenic_region ; MODIFIER	silent_mutation	Average:21.842; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0313966137	C -> DEL	N	N	silent_mutation	Average:21.842; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0313966137	NA	9.28E-07	mr1322	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313966137	NA	9.06E-06	mr1326	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313966137	NA	1.02E-06	mr1732	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313966137	7.12E-06	NA	mr1879	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313966137	1.49E-06	5.00E-06	mr1879	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251