Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0312020858:

Variant ID: vg0312020858 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 12020858
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCCATTCCACGAGACCGTGCGGTCTCGCGCTTTCCCTGCGCGATACCGTCCGCGATGTCATTTTCGCGCAATGGTTGAGCGAGACCGACGGTATATTTT[T/C]
ATAAAAAAAATTTGCATGTCGAATAATACTGAGAAAAAATTGTATGAACAGTGTATTTTTAAATTTAATTCTCTCATGGGAGGTCTAAAAGCAGTATTAT

Reverse complement sequence

ATAATACTGCTTTTAGACCTCCCATGAGAGAATTAAATTTAAAAATACACTGTTCATACAATTTTTTCTCAGTATTATTCGACATGCAAATTTTTTTTAT[A/G]
AAAATATACCGTCGGTCTCGCTCAACCATTGCGCGAAAATGACATCGCGGACGGTATCGCGCAGGGAAAGCGCGAGACCGCACGGTCTCGTGGAATGGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.20% 25.50% 0.36% 0.00% NA
All Indica  2759 97.10% 2.70% 0.22% 0.00% NA
All Japonica  1512 45.60% 54.10% 0.26% 0.00% NA
Aus  269 30.50% 68.40% 1.12% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.10% 0.60% 0.22% 0.00% NA
Indica III  913 95.10% 4.70% 0.22% 0.00% NA
Indica Intermediate  786 96.10% 3.70% 0.25% 0.00% NA
Temperate Japonica  767 79.70% 20.30% 0.00% 0.00% NA
Tropical Japonica  504 6.30% 93.30% 0.40% 0.00% NA
Japonica Intermediate  241 19.50% 79.70% 0.83% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 55.60% 40.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0312020858 T -> C LOC_Os03g21100.1 upstream_gene_variant ; 4377.0bp to feature; MODIFIER silent_mutation Average:73.294; most accessible tissue: Minghui63 flag leaf, score: 87.326 N N N N
vg0312020858 T -> C LOC_Os03g21120.1 downstream_gene_variant ; 924.0bp to feature; MODIFIER silent_mutation Average:73.294; most accessible tissue: Minghui63 flag leaf, score: 87.326 N N N N
vg0312020858 T -> C LOC_Os03g21110.1 intron_variant ; MODIFIER silent_mutation Average:73.294; most accessible tissue: Minghui63 flag leaf, score: 87.326 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0312020858 T C -0.02 -0.01 0.0 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0312020858 NA 1.22E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312020858 NA 3.90E-24 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312020858 4.56E-06 5.09E-25 mr1552 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312020858 NA 6.96E-12 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312020858 NA 5.85E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312020858 NA 6.14E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312020858 NA 6.39E-14 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251