RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0311437556:

Variant ID: vg0311437556 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 11437556
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGCGGGACTTCTAAAAGTAAAAAGTAAACCCTAATGATAATCATATTCGAGGGAAAGTAGCAGGCGAACCTAGAGGAGTACATTAGCAAAGTTGCTGAC[A/G]
GTTTTGACGGGACTGCTAGAAAGTAAAAAAAAATAATACAAATGATAATTATGTTCGATTTTCAAAATTCAGAGAAGGCAGTGGACGGGCCATAGGGGAG

Reverse complement sequence

CTCCCCTATGGCCCGTCCACTGCCTTCTCTGAATTTTGAAAATCGAACATAATTATCATTTGTATTATTTTTTTTTACTTTCTAGCAGTCCCGTCAAAAC[T/C]
GTCAGCAACTTTGCTAATGTACTCCTCTAGGTTCGCCTGCTACTTTCCCTCGAATATGATTATCATTAGGGTTTACTTTTTACTTTTAGAAGTCCCGCCA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.60%	18.20%	0.19%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.04%	0.00%	NA
All Japonica	1512	44.10%	55.40%	0.53%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.40%	0.13%	0.00%	NA
Temperate Japonica	767	2.90%	96.50%	0.65%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	61.80%	36.90%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	76.70%	23.30%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0311437556	A -> G	LOC_Os03g20240.1	downstream_gene_variant ; 4224.0bp to feature; MODIFIER	silent_mutation	Average:32.266; most accessible tissue: Callus, score: 57.038	N	N	N	N
vg0311437556	A -> G	LOC_Os03g20240-LOC_Os03g20250	intergenic_region ; MODIFIER	silent_mutation	Average:32.266; most accessible tissue: Callus, score: 57.038	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0311437556	NA	1.35E-19	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311437556	NA	4.23E-07	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311437556	NA	1.80E-06	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311437556	NA	5.76E-06	mr1096	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311437556	NA	1.78E-24	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311437556	3.82E-06	NA	mr1124	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311437556	5.23E-06	3.68E-08	mr1124	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311437556	NA	1.01E-21	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311437556	NA	1.87E-11	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311437556	NA	2.12E-29	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 86 entries

Previous1 2 3 4 5…9Next

Search for Variation information by Variation ID:

Detailed information for vg0311437556:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact