Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0310942067:

Variant ID: vg0310942067 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 10942067
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, G: 0.27, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


GAGAAGAGAAGCAGAGCCGGCGGCGGCGGCGGAGGGAGGAGATCCGGCGCCTCCCGCGCGCGTCGGTCGCCGCGCGAGCCGGCAACCGCGGCTGCCGGCG[C/G]
CGGAGGGAGGAGAGGAGAAGCAGAGCCGGTGCCGGCGGCGGAGGGAGGAGATCCGGCGCCGGCCGTCGGTGGAGGGAGGAGGGGAGTCGAAGCGGTGGCG

Reverse complement sequence

CGCCACCGCTTCGACTCCCCTCCTCCCTCCACCGACGGCCGGCGCCGGATCTCCTCCCTCCGCCGCCGGCACCGGCTCTGCTTCTCCTCTCCTCCCTCCG[G/C]
CGCCGGCAGCCGCGGTTGCCGGCTCGCGCGGCGACCGACGCGCGCGGGAGGCGCCGGATCTCCTCCCTCCGCCGCCGCCGCCGGCTCTGCTTCTCTTCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.90% 35.20% 12.95% 14.94% NA
All Indica  2759 53.50% 2.50% 19.35% 24.61% NA
All Japonica  1512 2.10% 95.50% 2.05% 0.33% NA
Aus  269 76.60% 6.70% 13.75% 2.97% NA
Indica I  595 67.90% 2.00% 24.37% 5.71% NA
Indica II  465 40.20% 1.10% 23.66% 35.05% NA
Indica III  913 51.00% 2.80% 11.17% 34.94% NA
Indica Intermediate  786 53.40% 3.30% 22.52% 20.74% NA
Temperate Japonica  767 0.10% 99.30% 0.26% 0.26% NA
Tropical Japonica  504 5.40% 91.10% 3.17% 0.40% NA
Japonica Intermediate  241 1.70% 92.50% 5.39% 0.41% NA
VI/Aromatic  96 13.50% 85.40% 1.04% 0.00% NA
Intermediate  90 20.00% 54.40% 10.00% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0310942067 C -> DEL N N silent_mutation Average:90.136; most accessible tissue: Zhenshan97 panicle, score: 97.512 N N N N
vg0310942067 C -> G LOC_Os03g19462.1 upstream_gene_variant ; 2144.0bp to feature; MODIFIER silent_mutation Average:90.136; most accessible tissue: Zhenshan97 panicle, score: 97.512 N N N N
vg0310942067 C -> G LOC_Os03g19452.2 upstream_gene_variant ; 585.0bp to feature; MODIFIER silent_mutation Average:90.136; most accessible tissue: Zhenshan97 panicle, score: 97.512 N N N N
vg0310942067 C -> G LOC_Os03g19452.1 intron_variant ; MODIFIER silent_mutation Average:90.136; most accessible tissue: Zhenshan97 panicle, score: 97.512 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0310942067 C G 0.0 0.01 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0310942067 NA 1.52E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 8.63E-12 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 9.59E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 9.24E-17 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 3.48E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 6.33E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 1.55E-07 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 1.80E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 1.44E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 2.12E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 3.39E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 3.95E-06 NA mr1696 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 2.93E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 1.73E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 1.16E-59 mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 6.11E-13 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 5.99E-08 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 4.52E-06 mr1388_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 1.52E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 1.56E-09 mr1454_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 1.29E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 2.16E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 2.55E-09 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 3.43E-16 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310942067 NA 2.10E-08 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251