Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0310513409:

Variant ID: vg0310513409 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 10513409
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAAAACGGAGGTAAAAGGAGTAGTAAGTACTCAATGCTTGCATATGCAACAACATTTTTCTGCCTGCTAATAGTCTAATGAGCCTCACTCCGGTGCTTT[C/T]
TACTTGTAGTAGAAAATAATCCGAGCCGTTGATCGTATATAATCGTCAGGTTGAGATCTAGTTCTACTACCACCACGCTTAGTGGTAGTAGAAACATGGA

Reverse complement sequence

TCCATGTTTCTACTACCACTAAGCGTGGTGGTAGTAGAACTAGATCTCAACCTGACGATTATATACGATCAACGGCTCGGATTATTTTCTACTACAAGTA[G/A]
AAAGCACCGGAGTGAGGCTCATTAGACTATTAGCAGGCAGAAAAATGTTGTTGCATATGCAAGCATTGAGTACTTACTACTCCTTTTACCTCCGTTTTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.50%	17.90%	27.08%	29.56%	NA
All Indica	2759	1.10%	29.00%	43.39%	26.53%	NA
All Japonica	1512	71.30%	1.50%	0.73%	26.52%	NA
Aus	269	1.50%	2.60%	14.13%	81.78%	NA
Indica I	595	0.80%	20.30%	60.50%	18.32%	NA
Indica II	465	0.40%	24.50%	45.81%	29.25%	NA
Indica III	913	1.60%	38.00%	29.24%	31.11%	NA
Indica Intermediate	786	1.00%	27.70%	45.42%	25.83%	NA
Temperate Japonica	767	98.80%	0.00%	0.52%	0.65%	NA
Tropical Japonica	504	26.60%	4.00%	0.40%	69.05%	NA
Japonica Intermediate	241	77.20%	0.80%	2.07%	19.92%	NA
VI/Aromatic	96	66.70%	0.00%	12.50%	20.83%	NA
Intermediate	90	31.10%	17.80%	24.44%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0310513409	C -> T	LOC_Os03g18750.1	upstream_gene_variant ; 2198.0bp to feature; MODIFIER	silent_mutation	Average:41.26; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0310513409	C -> T	LOC_Os03g18760.1	downstream_gene_variant ; 167.0bp to feature; MODIFIER	silent_mutation	Average:41.26; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0310513409	C -> T	LOC_Os03g18770.1	downstream_gene_variant ; 3699.0bp to feature; MODIFIER	silent_mutation	Average:41.26; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0310513409	C -> T	LOC_Os03g18750-LOC_Os03g18760	intergenic_region ; MODIFIER	silent_mutation	Average:41.26; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0310513409	C -> DEL	N	N	silent_mutation	Average:41.26; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0310513409	NA	1.71E-19	mr1422	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310513409	NA	9.91E-09	mr1575	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310513409	NA	5.91E-07	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310513409	NA	2.13E-07	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310513409	NA	7.66E-07	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310513409	8.89E-09	1.47E-07	mr1925	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310513409	NA	3.75E-13	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251