Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0310513352:

Variant ID: vg0310513352 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 10513352
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGTTTAGATTCGTTAACGTCAATTTAAATATGAGAAATGTTAGAATGACTTACATTATAAAACGGAGGTAAAAGGAGTAGTAAGTACTCAATGCTTGCA[T/A]
ATGCAACAACATTTTTCTGCCTGCTAATAGTCTAATGAGCCTCACTCCGGTGCTTTCTACTTGTAGTAGAAAATAATCCGAGCCGTTGATCGTATATAAT

Reverse complement sequence

ATTATATACGATCAACGGCTCGGATTATTTTCTACTACAAGTAGAAAGCACCGGAGTGAGGCTCATTAGACTATTAGCAGGCAGAAAAATGTTGTTGCAT[A/T]
TGCAAGCATTGAGTACTTACTACTCCTTTTACCTCCGTTTTATAATGTAAGTCATTCTAACATTTCTCATATTTAAATTGACGTTAACGAATCTAAACAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.80%	2.70%	2.22%	0.28%	NA
All Indica	2759	99.10%	0.00%	0.40%	0.47%	NA
All Japonica	1512	85.60%	8.20%	6.15%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.80%	0.00%	1.18%	0.00%	NA
Indica II	465	96.60%	0.00%	0.86%	2.58%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.00%	0.00%	0.13%	NA
Temperate Japonica	767	76.50%	13.40%	10.04%	0.00%	NA
Tropical Japonica	504	99.20%	0.40%	0.40%	0.00%	NA
Japonica Intermediate	241	86.30%	7.90%	5.81%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	4.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0310513352	T -> A	LOC_Os03g18750.1	upstream_gene_variant ; 2141.0bp to feature; MODIFIER	silent_mutation	Average:45.928; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0310513352	T -> A	LOC_Os03g18760.1	downstream_gene_variant ; 224.0bp to feature; MODIFIER	silent_mutation	Average:45.928; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0310513352	T -> A	LOC_Os03g18770.1	downstream_gene_variant ; 3756.0bp to feature; MODIFIER	silent_mutation	Average:45.928; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0310513352	T -> A	LOC_Os03g18750-LOC_Os03g18760	intergenic_region ; MODIFIER	silent_mutation	Average:45.928; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0310513352	T -> DEL	N	N	silent_mutation	Average:45.928; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0310513352	6.77E-07	6.77E-07	mr1011	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251