Variant ID: vg0310496278 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 10496278 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTTCTTCATGTAGATATGAATTAGTGTTATATATTTGTCAAGCAAATTTGACACCAAGTGAAATTATTTTAAAAATGATCATGACATTAATTATTATAT[G/A]
TTAGCTAAATTATTTGAAAAATAATTATGACATTACATATTATATGTCGGCACCATATGTCGTGATGAATTTAGCAGTTCCATATAACTATTATAAGTGA
TCACTTATAATAGTTATATGGAACTGCTAAATTCATCACGACATATGGTGCCGACATATAATATGTAATGTCATAATTATTTTTCAAATAATTTAGCTAA[C/T]
ATATAATAATTAATGTCATGATCATTTTTAAAATAATTTCACTTGGTGTCAAATTTGCTTGACAAATATATAACACTAATTCATATCTACATGAAGAAAA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 92.20% | 5.50% | 1.06% | 1.23% | NA |
All Indica | 2759 | 99.70% | 0.20% | 0.07% | 0.04% | NA |
All Japonica | 1512 | 77.40% | 16.20% | 2.91% | 3.44% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.40% | 0.30% | 0.25% | 0.13% | NA |
Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 43.10% | 39.90% | 7.74% | 9.33% | NA |
Japonica Intermediate | 241 | 79.70% | 16.20% | 2.07% | 2.07% | NA |
VI/Aromatic | 96 | 94.80% | 4.20% | 0.00% | 1.04% | NA |
Intermediate | 90 | 84.40% | 6.70% | 4.44% | 4.44% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0310496278 | G -> A | LOC_Os03g18729-LOC_Os03g18740 | intergenic_region ; MODIFIER | silent_mutation | Average:30.125; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
vg0310496278 | G -> DEL | N | N | silent_mutation | Average:30.125; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0310496278 | NA | 2.14E-07 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0310496278 | NA | 1.43E-09 | mr1852 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0310496278 | NA | 9.50E-06 | mr1397_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0310496278 | NA | 1.64E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0310496278 | NA | 3.83E-13 | mr1864_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0310496278 | NA | 2.40E-06 | mr1923_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |