Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0310272191:

Variant ID: vg0310272191 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 10272191
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATATTTATTATATTTATTTTTTAAGTTGCTGGATTGTTTCCAATAAAAAATGACTCTTTAAGGCCCTAGCATCAATTAACTTCAAATACGACTCTCTTTA[G/A]
AATTTGGGATTTCATCATGTACAGCAACATAACTCAATTTATAGTTGCCTATCAACGTAACTAACCTTAAAAGCTGCCTGCACCTGCCAGCGGTAAGATT

Reverse complement sequence

AATCTTACCGCTGGCAGGTGCAGGCAGCTTTTAAGGTTAGTTACGTTGATAGGCAACTATAAATTGAGTTATGTTGCTGTACATGATGAAATCCCAAATT[C/T]
TAAAGAGAGTCGTATTTGAAGTTAATTGATGCTAGGGCCTTAAAGAGTCATTTTTTATTGGAAACAATCCAGCAACTTAAAAAATAAATATAATAAATAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.80%	1.90%	0.21%	0.00%	NA
All Indica	2759	96.30%	3.30%	0.36%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	83.90%	15.30%	0.84%	0.00%	NA
Indica II	465	99.10%	0.00%	0.86%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.10%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0310272191	G -> A	LOC_Os03g18320.1	upstream_gene_variant ; 417.0bp to feature; MODIFIER	silent_mutation	Average:43.534; most accessible tissue: Zhenshan97 root, score: 61.518	N	N	N	N
vg0310272191	G -> A	LOC_Os03g18330.1	upstream_gene_variant ; 2685.0bp to feature; MODIFIER	silent_mutation	Average:43.534; most accessible tissue: Zhenshan97 root, score: 61.518	N	N	N	N
vg0310272191	G -> A	LOC_Os03g18340.1	upstream_gene_variant ; 4851.0bp to feature; MODIFIER	silent_mutation	Average:43.534; most accessible tissue: Zhenshan97 root, score: 61.518	N	N	N	N
vg0310272191	G -> A	LOC_Os03g18310.1	downstream_gene_variant ; 1018.0bp to feature; MODIFIER	silent_mutation	Average:43.534; most accessible tissue: Zhenshan97 root, score: 61.518	N	N	N	N
vg0310272191	G -> A	LOC_Os03g18310.3	downstream_gene_variant ; 2803.0bp to feature; MODIFIER	silent_mutation	Average:43.534; most accessible tissue: Zhenshan97 root, score: 61.518	N	N	N	N
vg0310272191	G -> A	LOC_Os03g18310.2	downstream_gene_variant ; 1018.0bp to feature; MODIFIER	silent_mutation	Average:43.534; most accessible tissue: Zhenshan97 root, score: 61.518	N	N	N	N
vg0310272191	G -> A	LOC_Os03g18320-LOC_Os03g18330	intergenic_region ; MODIFIER	silent_mutation	Average:43.534; most accessible tissue: Zhenshan97 root, score: 61.518	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0310272191	1.77E-06	NA	Plant_height	Ind_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0310272191	NA	1.52E-07	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191	NA	2.93E-06	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191	NA	3.55E-07	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191	NA	2.61E-06	mr1169_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191	NA	1.05E-07	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191	NA	1.43E-06	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191	NA	7.38E-07	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191	NA	1.74E-06	mr1376_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191	NA	1.64E-06	mr1431_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191	NA	2.77E-07	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191	NA	3.93E-10	mr1758_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191	NA	1.84E-06	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191	NA	1.20E-07	mr1923_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251