Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0310028378:

Variant ID: vg0310028378 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 10028378
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


CGCGGAGGGGTTCCGGCTGCTGGACGTCCGGCCGGAGTGGGAGCGCGCGCGCGCCGCCGTGCGGGGCTCGGCGCACGCGCCGCTGTTCGTCGGGGACGAC[G/A]
ACACGGGCCCCGTCACGCTGCTCAAGAAGTGGGTCCACTTCGGCTACATCGGCCTCTGGACCGGCCAGTCCTTCACCAAGATGAACGACCGCTTCCTCGA

Reverse complement sequence

TCGAGGAAGCGGTCGTTCATCTTGGTGAAGGACTGGCCGGTCCAGAGGCCGATGTAGCCGAAGTGGACCCACTTCTTGAGCAGCGTGACGGGGCCCGTGT[C/T]
GTCGTCCCCGACGAACAGCGGCGCGTGCGCCGAGCCCCGCACGGCGGCGCGCGCGCGCTCCCACTCCGGCCGGACGTCCAGCAGCCGGAACCCCTCCGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.30% 32.40% 0.32% 0.00% NA
All Indica  2759 56.10% 43.60% 0.33% 0.00% NA
All Japonica  1512 98.40% 1.60% 0.00% 0.00% NA
Aus  269 5.90% 92.90% 1.12% 0.00% NA
Indica I  595 44.70% 54.80% 0.50% 0.00% NA
Indica II  465 25.40% 74.60% 0.00% 0.00% NA
Indica III  913 79.60% 19.90% 0.44% 0.00% NA
Indica Intermediate  786 55.60% 44.10% 0.25% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.70% 0.00% 0.00% NA
VI/Aromatic  96 69.80% 29.20% 1.04% 0.00% NA
Intermediate  90 70.00% 27.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0310028378 G -> A LOC_Os03g18020.1 missense_variant ; p.Asp92Asn; MODERATE nonsynonymous_codon ; D92N Average:90.881; most accessible tissue: Minghui63 flag leaf, score: 96.312 possibly damaging 1.819 DELETERIOUS 0.01

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0310028378 G A 0.01 0.01 0.01 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0310028378 NA 9.90E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310028378 NA 2.49E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310028378 NA 8.37E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310028378 NA 4.93E-15 mr1553 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310028378 NA 8.97E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310028378 NA 3.89E-14 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310028378 NA 5.78E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310028378 NA 1.00E-05 mr1865_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251