Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0309414251:

Variant ID: vg0309414251 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 9414251
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


CATCATAATTTTAAATTTTGCAATAAGTTTACAAAACTACAAATATGTAGTATTCATATTGTATTTTATATACGTGTTAGTTATTAATTATTTTTAATAT[C/T]
AAATTTTAGTTATTTGTAAATTATATATATTCCTATATCTACTCTAGACTCGTCTTTTAATATTTCTTTTTTTAATTCCGAATTTTCTGTAAATTGTATT

Reverse complement sequence

AATACAATTTACAGAAAATTCGGAATTAAAAAAAGAAATATTAAAAGACGAGTCTAGAGTAGATATAGGAATATATATAATTTACAAATAACTAAAATTT[G/A]
ATATTAAAAATAATTAATAACTAACACGTATATAAAATACAATATGAATACTACATATTTGTAGTTTTGTAAACTTATTGCAAAATTTAAAATTATGATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.20% 7.70% 3.17% 0.00% NA
All Indica  2759 89.50% 5.60% 4.86% 0.00% NA
All Japonica  1512 99.30% 0.60% 0.07% 0.00% NA
Aus  269 24.90% 72.10% 2.97% 0.00% NA
Indica I  595 80.20% 10.60% 9.24% 0.00% NA
Indica II  465 95.90% 1.90% 2.15% 0.00% NA
Indica III  913 96.80% 2.00% 1.20% 0.00% NA
Indica Intermediate  786 84.40% 8.30% 7.38% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.50% 0.41% 0.00% NA
VI/Aromatic  96 90.60% 2.10% 7.29% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0309414251 C -> T LOC_Os03g16940.1 downstream_gene_variant ; 4612.0bp to feature; MODIFIER silent_mutation Average:31.734; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0309414251 C -> T LOC_Os03g16920.1 intron_variant ; MODIFIER silent_mutation Average:31.734; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0309414251 NA 1.48E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309414251 NA 1.68E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309414251 NA 4.53E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309414251 NA 4.36E-06 mr1217 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309414251 NA 3.13E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309414251 NA 1.16E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309414251 6.21E-06 NA mr1298 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309414251 NA 2.06E-06 mr1298 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309414251 NA 3.00E-06 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309414251 NA 1.66E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309414251 NA 1.37E-06 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309414251 NA 1.69E-06 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309414251 NA 6.33E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309414251 NA 2.61E-06 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309414251 NA 2.59E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309414251 NA 2.38E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309414251 NA 2.07E-06 mr1789 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309414251 3.54E-07 3.54E-07 mr1845 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309414251 NA 8.52E-07 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309414251 NA 1.09E-06 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251