Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0309056044:

Variant ID: vg0309056044 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 9056044
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTCCCATTTTGTTCCCTAGGATGTCCCGGAGATCGTCCGCCCGTCGCCGTCGTCCTCCCGTCGCTCGTCGTCGTCGTTCGCCGTCGTCTCCACTCGCGC[T/C]
GGCCAACCTCGGTGAGAAACTCCCTCTCCTCCCTCTTTCCCTCTCTCTCGTGTGCGCCGCTGTTGTCACGCCCAGAAATTCCCGAATAGAATTCCAAGCA

Reverse complement sequence

TGCTTGGAATTCTATTCGGGAATTTCTGGGCGTGACAACAGCGGCGCACACGAGAGAGAGGGAAAGAGGGAGGAGAGGGAGTTTCTCACCGAGGTTGGCC[A/G]
GCGCGAGTGGAGACGACGGCGAACGACGACGACGAGCGACGGGAGGACGACGGCGACGGGCGGACGATCTCCGGGACATCCTAGGGAACAAAATGGGAAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.90%	4.70%	15.83%	29.60%	NA
All Indica	2759	29.80%	2.50%	22.36%	45.34%	NA
All Japonica	1512	89.00%	9.70%	0.53%	0.79%	NA
Aus	269	22.70%	0.40%	36.43%	40.52%	NA
Indica I	595	67.10%	0.50%	6.55%	25.88%	NA
Indica II	465	11.00%	1.30%	14.62%	73.12%	NA
Indica III	913	18.70%	5.30%	37.79%	38.23%	NA
Indica Intermediate	786	25.40%	1.70%	20.99%	51.91%	NA
Temperate Japonica	767	84.90%	14.10%	0.00%	1.04%	NA
Tropical Japonica	504	92.50%	6.00%	1.19%	0.40%	NA
Japonica Intermediate	241	95.00%	3.30%	0.83%	0.83%	NA
VI/Aromatic	96	80.20%	0.00%	14.58%	5.21%	NA
Intermediate	90	57.80%	5.60%	12.22%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0309056044	T -> C	LOC_Os03g16410.1	upstream_gene_variant ; 3722.0bp to feature; MODIFIER	silent_mutation	Average:54.142; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N
vg0309056044	T -> C	LOC_Os03g16400.1	downstream_gene_variant ; 4586.0bp to feature; MODIFIER	silent_mutation	Average:54.142; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N
vg0309056044	T -> C	LOC_Os03g16410-LOC_Os03g16420	intergenic_region ; MODIFIER	silent_mutation	Average:54.142; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N
vg0309056044	T -> DEL	N	N	silent_mutation	Average:54.142; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0309056044	NA	3.97E-07	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309056044	NA	2.39E-09	mr1565	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309056044	NA	5.22E-08	mr1875	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309056044	NA	3.20E-06	mr1937	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309056044	NA	2.70E-09	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309056044	NA	4.21E-08	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309056044	NA	1.04E-10	mr1565_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251