Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0308567901:

Variant ID: vg0308567901 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 8567901
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

AAAATTATATGTATAGATTTGTCTTGGAAAATACTTTCATAAAAGTATACATATAGCACTTTTCAATAAATATTTTTATAGAAATAAAAAGTCAAAGTTG[T/A]
GTTTTGGAAATCGTGTCGTTGTTCTAAACGACTTCCTTTACAAGTATAGAGGGAGTATATGGTAAGAGCTGTGGACCATTTTAACTTTTAAATCTACAAT

Reverse complement sequence

ATTGTAGATTTAAAAGTTAAAATGGTCCACAGCTCTTACCATATACTCCCTCTATACTTGTAAAGGAAGTCGTTTAGAACAACGACACGATTTCCAAAAC[A/T]
CAACTTTGACTTTTTATTTCTATAAAAATATTTATTGAAAAGTGCTATATGTATACTTTTATGAAAGTATTTTCCAAGACAAATCTATACATATAATTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.40%	44.70%	0.49%	0.36%	NA
All Indica	2759	77.60%	21.30%	0.83%	0.25%	NA
All Japonica	1512	3.90%	96.10%	0.00%	0.00%	NA
Aus	269	95.90%	0.70%	0.00%	3.35%	NA
Indica I	595	85.70%	13.30%	1.01%	0.00%	NA
Indica II	465	34.00%	65.40%	0.65%	0.00%	NA
Indica III	913	95.10%	3.60%	0.88%	0.44%	NA
Indica Intermediate	786	77.00%	21.90%	0.76%	0.38%	NA
Temperate Japonica	767	1.00%	99.00%	0.00%	0.00%	NA
Tropical Japonica	504	9.30%	90.70%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	87.50%	11.50%	0.00%	1.04%	NA
Intermediate	90	34.40%	65.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0308567901	T -> A	LOC_Os03g15560.1	upstream_gene_variant ; 544.0bp to feature; MODIFIER	silent_mutation	Average:31.476; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N
vg0308567901	T -> A	LOC_Os03g15570.1	downstream_gene_variant ; 4964.0bp to feature; MODIFIER	silent_mutation	Average:31.476; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N
vg0308567901	T -> A	LOC_Os03g15550-LOC_Os03g15560	intergenic_region ; MODIFIER	silent_mutation	Average:31.476; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N
vg0308567901	T -> DEL	N	N	silent_mutation	Average:31.476; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0308567901	NA	1.58E-15	mr1146	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308567901	NA	7.71E-19	mr1146_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308567901	NA	3.94E-32	mr1150_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308567901	NA	9.60E-10	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308567901	7.77E-06	NA	mr1497_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308567901	NA	8.85E-09	mr1889_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251