Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0308147280:

Variant ID: vg0308147280 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 8147280
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCTAATATTCCTTATTTTTAATTCCAAATTTTTATTATTTCCTAATTGTATTTCTATATGGACTCTATACTCCAATTCTAATATTCCTTATTTTTAATT[T/C]
CGAATTTCAGTTATTTCCTAATTGCATTTCTATATGGACTCTAGTCTCCTCTTCTAATATTCTTTATTTTTAATTTAGAATTTCAGTTATTTCCTAATTG

Reverse complement sequence

CAATTAGGAAATAACTGAAATTCTAAATTAAAAATAAAGAATATTAGAAGAGGAGACTAGAGTCCATATAGAAATGCAATTAGGAAATAACTGAAATTCG[A/G]
AATTAAAAATAAGGAATATTAGAATTGGAGTATAGAGTCCATATAGAAATACAATTAGGAAATAATAAAAATTTGGAATTAAAAATAAGGAATATTAGAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	21.50%	0.20%	23.74%	54.53%	NA
All Indica	2759	1.60%	0.00%	17.29%	81.12%	NA
All Japonica	1512	61.10%	0.50%	25.00%	13.36%	NA
Aus	269	1.10%	0.00%	65.43%	33.46%	NA
Indica I	595	1.30%	0.00%	6.39%	92.27%	NA
Indica II	465	1.50%	0.00%	35.48%	63.01%	NA
Indica III	913	1.40%	0.10%	13.36%	85.10%	NA
Indica Intermediate	786	1.90%	0.00%	19.34%	78.75%	NA
Temperate Japonica	767	70.10%	0.80%	18.25%	10.82%	NA
Tropical Japonica	504	64.10%	0.20%	21.83%	13.89%	NA
Japonica Intermediate	241	26.10%	0.40%	53.11%	20.33%	NA
VI/Aromatic	96	20.80%	0.00%	66.67%	12.50%	NA
Intermediate	90	31.10%	0.00%	30.00%	38.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0308147280	T -> C	LOC_Os03g14930.1	downstream_gene_variant ; 3962.0bp to feature; MODIFIER	silent_mutation	Average:16.355; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0308147280	T -> C	LOC_Os03g14940.1	downstream_gene_variant ; 2185.0bp to feature; MODIFIER	silent_mutation	Average:16.355; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0308147280	T -> C	LOC_Os03g14940-LOC_Os03g14950	intergenic_region ; MODIFIER	silent_mutation	Average:16.355; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0308147280	T -> DEL	N	N	silent_mutation	Average:16.355; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0308147280	NA	3.64E-09	mr1275	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251