Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0308057027:

Variant ID: vg0308057027 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 8057027
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAAGCACGGCATACTCATATGTTACCTCACCTCACGCATATATATTTTAACTCACCTCTTTAAACGTATTCCTATAAGAGAAAAAAATAATACATAAACC[C/A]
TGTGCCCAAAATAACCTAATCCTAAGATTTATCCTTAAGATTGGATTTTATTTTACTAAGGGAGTATTCACGAGAAAAAAAAACATAAGTACGATAAAAA

Reverse complement sequence

TTTTTATCGTACTTATGTTTTTTTTTCTCGTGAATACTCCCTTAGTAAAATAAAATCCAATCTTAAGGATAAATCTTAGGATTAGGTTATTTTGGGCACA[G/T]
GGTTTATGTATTATTTTTTTCTCTTATAGGAATACGTTTAAAGAGGTGAGTTAAAATATATATGCGTGAGGTGAGGTAACATATGAGTATGCCGTGCTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.70%	1.20%	4.97%	9.14%	NA
All Indica	2759	79.20%	1.70%	7.18%	11.92%	NA
All Japonica	1512	91.30%	0.10%	2.12%	6.48%	NA
Aus	269	96.70%	2.60%	0.74%	0.00%	NA
Indica I	595	84.20%	0.70%	7.06%	8.07%	NA
Indica II	465	82.80%	0.90%	7.31%	9.03%	NA
Indica III	913	72.10%	3.20%	7.34%	17.42%	NA
Indica Intermediate	786	81.60%	1.30%	7.00%	10.18%	NA
Temperate Japonica	767	97.70%	0.00%	1.04%	1.30%	NA
Tropical Japonica	504	79.20%	0.40%	4.37%	16.07%	NA
Japonica Intermediate	241	96.30%	0.00%	0.83%	2.90%	NA
VI/Aromatic	96	96.90%	0.00%	2.08%	1.04%	NA
Intermediate	90	94.40%	0.00%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0308057027	C -> A	LOC_Os03g14800.1	upstream_gene_variant ; 4480.0bp to feature; MODIFIER	silent_mutation	Average:32.333; most accessible tissue: Zhenshan97 root, score: 70.636	N	N	N	N
vg0308057027	C -> A	LOC_Os03g14800.3	upstream_gene_variant ; 4480.0bp to feature; MODIFIER	silent_mutation	Average:32.333; most accessible tissue: Zhenshan97 root, score: 70.636	N	N	N	N
vg0308057027	C -> A	LOC_Os03g14800.4	upstream_gene_variant ; 4460.0bp to feature; MODIFIER	silent_mutation	Average:32.333; most accessible tissue: Zhenshan97 root, score: 70.636	N	N	N	N
vg0308057027	C -> A	LOC_Os03g14800.5	upstream_gene_variant ; 4460.0bp to feature; MODIFIER	silent_mutation	Average:32.333; most accessible tissue: Zhenshan97 root, score: 70.636	N	N	N	N
vg0308057027	C -> A	LOC_Os03g14800.6	upstream_gene_variant ; 4460.0bp to feature; MODIFIER	silent_mutation	Average:32.333; most accessible tissue: Zhenshan97 root, score: 70.636	N	N	N	N
vg0308057027	C -> A	LOC_Os03g14810.1	downstream_gene_variant ; 4268.0bp to feature; MODIFIER	silent_mutation	Average:32.333; most accessible tissue: Zhenshan97 root, score: 70.636	N	N	N	N
vg0308057027	C -> A	LOC_Os03g14800-LOC_Os03g14810	intergenic_region ; MODIFIER	silent_mutation	Average:32.333; most accessible tissue: Zhenshan97 root, score: 70.636	N	N	N	N
vg0308057027	C -> DEL	N	N	silent_mutation	Average:32.333; most accessible tissue: Zhenshan97 root, score: 70.636	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0308057027	2.35E-06	2.35E-06	mr1808	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251