RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0308054850:

Variant ID: vg0308054850 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 8054850
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

TTATTTTCTAGAAGTCCCGTCAACCGTTGGAGGCTCTGCAACTATACTCTTATACACCCCGCCCGCTGCTTCTCCTTTTTATTATTGTCATTGAGATTTT[A/T]
AAAATCGAAAATGATTATCAATATGTTTTTTCTTTTTTACTTTCTAGAAGTCCCGGCAACCGCTTTACTTGTTTGCTTCACGGCCTGCCTGACGTCCCTC

Reverse complement sequence

GAGGGACGTCAGGCAGGCCGTGAAGCAAACAAGTAAAGCGGTTGCCGGGACTTCTAGAAAGTAAAAAAGAAAAAACATATTGATAATCATTTTCGATTTT[T/A]
AAAATCTCAATGACAATAATAAAAAGGAGAAGCAGCGGGCGGGGTGTATAAGAGTATAGTTGCAGAGCCTCCAACGGTTGACGGGACTTCTAGAAAATAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.40%	41.30%	0.30%	0.00%	NA
All Indica	2759	31.70%	67.90%	0.40%	0.00%	NA
All Japonica	1512	96.60%	3.30%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	23.40%	76.00%	0.67%	0.00%	NA
Indica II	465	9.20%	90.30%	0.43%	0.00%	NA
Indica III	913	41.00%	58.80%	0.22%	0.00%	NA
Indica Intermediate	786	40.60%	59.00%	0.38%	0.00%	NA
Temperate Japonica	767	99.10%	0.80%	0.13%	0.00%	NA
Tropical Japonica	504	91.70%	8.10%	0.20%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	67.80%	31.10%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0308054850	A -> T	LOC_Os03g14800.1	upstream_gene_variant ; 2303.0bp to feature; MODIFIER	silent_mutation	Average:28.183; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N
vg0308054850	A -> T	LOC_Os03g14800.3	upstream_gene_variant ; 2303.0bp to feature; MODIFIER	silent_mutation	Average:28.183; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N
vg0308054850	A -> T	LOC_Os03g14800.4	upstream_gene_variant ; 2283.0bp to feature; MODIFIER	silent_mutation	Average:28.183; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N
vg0308054850	A -> T	LOC_Os03g14800.5	upstream_gene_variant ; 2283.0bp to feature; MODIFIER	silent_mutation	Average:28.183; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N
vg0308054850	A -> T	LOC_Os03g14800.6	upstream_gene_variant ; 2283.0bp to feature; MODIFIER	silent_mutation	Average:28.183; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N
vg0308054850	A -> T	LOC_Os03g14800-LOC_Os03g14810	intergenic_region ; MODIFIER	silent_mutation	Average:28.183; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N

Showing 1 to 6 of 6 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0308054850	9.78E-06	NA	Grain_length	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0308054850	2.95E-06	NA	Grain_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0308054850	NA	1.12E-08	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 3 of 3 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0308054850:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact