Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307967118:

Variant ID: vg0307967118 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 7967118
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

TGAGGGATGAGTCAATTCTTTTTGGTCTTGATGATAAAAGAAATATGACTTAGAATTTAGGGTTAGAAAGGGGTGTATAGTAGTTATTCTAAAGTCACGT[C/A]
GAATTGGATATGGGTGACATAGAACCAATTCAAACACGGATAACGTACCAAAATTTTAACGAAAACATTTTCAATTTTTATAATAATAGAGATAGAGATT

Reverse complement sequence

AATCTCTATCTCTATTATTATAAAAATTGAAAATGTTTTCGTTAAAATTTTGGTACGTTATCCGTGTTTGAATTGGTTCTATGTCACCCATATCCAATTC[G/T]
ACGTGACTTTAGAATAACTACTATACACCCCTTTCTAACCCTAAATTCTAAGTCATATTTCTTTTATCATCAAGACCAAAAAGAATTGACTCATCCCTCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.30%	9.00%	0.72%	0.00%	NA
All Indica	2759	99.60%	0.30%	0.04%	0.00%	NA
All Japonica	1512	74.50%	23.30%	2.12%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.50%	0.40%	0.11%	0.00%	NA
Indica Intermediate	786	99.50%	0.50%	0.00%	0.00%	NA
Temperate Japonica	767	96.10%	1.30%	2.61%	0.00%	NA
Tropical Japonica	504	39.30%	59.70%	0.99%	0.00%	NA
Japonica Intermediate	241	79.70%	17.40%	2.90%	0.00%	NA
VI/Aromatic	96	49.00%	51.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	14.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0307967118	C -> A	LOC_Os03g14654.1	upstream_gene_variant ; 1017.0bp to feature; MODIFIER	silent_mutation	Average:45.346; most accessible tissue: Zhenshan97 young leaf, score: 69.263	N	N	N	N
vg0307967118	C -> A	LOC_Os03g14654-LOC_Os03g14669	intergenic_region ; MODIFIER	silent_mutation	Average:45.346; most accessible tissue: Zhenshan97 young leaf, score: 69.263	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0307967118	NA	9.32E-07	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307967118	NA	8.13E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307967118	NA	4.31E-06	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307967118	NA	3.48E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307967118	NA	9.22E-07	mr1078_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307967118	NA	2.77E-06	mr1099_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307967118	NA	5.28E-08	mr1222_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307967118	7.91E-06	NA	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307967118	NA	4.82E-08	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307967118	NA	1.34E-07	mr1359_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307967118	NA	2.65E-07	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307967118	NA	1.53E-07	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307967118	7.53E-06	2.59E-11	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307967118	NA	1.59E-06	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307967118	NA	8.60E-06	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307967118	NA	8.71E-08	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307967118	NA	5.75E-06	mr1844_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307967118	NA	1.25E-06	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307967118	NA	1.97E-07	mr1929_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251