Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307393257:

Variant ID: vg0307393257 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 7393257
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.02, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

GACGAACTTGACGTCATGAGCCGTTTTTTTCGCCGAATTCCGCAATCGGCGGTTCTTTTTGGCCTCCGCGGAGCAAAGACCAAAAAGACTCTGCAAAATG[T/C]
GGAATAAGGGAGACGGCTCACGACGAGCCACAGAGGCAGGGCGCTCAGGAGCAGGAGGCGGCTGAGTGGAAGAGGAGGGGATGTCCCGAGCAGCTGAGGA

Reverse complement sequence

TCCTCAGCTGCTCGGGACATCCCCTCCTCTTCCACTCAGCCGCCTCCTGCTCCTGAGCGCCCTGCCTCTGTGGCTCGTCGTGAGCCGTCTCCCTTATTCC[A/G]
CATTTTGCAGAGTCTTTTTGGTCTTTGCTCCGCGGAGGCCAAAAAGAACCGCCGATTGCGGAATTCGGCGAAAAAAACGGCTCATGACGTCAAGTTCGTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.40%	20.60%	30.70%	0.23%	NA
All Indica	2759	29.70%	25.60%	44.47%	0.18%	NA
All Japonica	1512	93.40%	0.70%	5.82%	0.13%	NA
Aus	269	2.20%	72.90%	24.91%	0.00%	NA
Indica I	595	14.10%	27.20%	58.66%	0.00%	NA
Indica II	465	8.60%	45.20%	45.81%	0.43%	NA
Indica III	913	54.40%	14.80%	30.78%	0.00%	NA
Indica Intermediate	786	25.30%	25.40%	48.85%	0.38%	NA
Temperate Japonica	767	97.00%	0.50%	2.35%	0.13%	NA
Tropical Japonica	504	86.10%	1.20%	12.70%	0.00%	NA
Japonica Intermediate	241	97.10%	0.00%	2.49%	0.41%	NA
VI/Aromatic	96	8.30%	47.90%	42.71%	1.04%	NA
Intermediate	90	47.80%	17.80%	31.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0307393257	T -> C	LOC_Os03g13660.1	upstream_gene_variant ; 3622.0bp to feature; MODIFIER	silent_mutation	Average:14.681; most accessible tissue: Callus, score: 31.305	N	N	N	N
vg0307393257	T -> C	LOC_Os03g13680.1	downstream_gene_variant ; 4528.0bp to feature; MODIFIER	silent_mutation	Average:14.681; most accessible tissue: Callus, score: 31.305	N	N	N	N
vg0307393257	T -> C	LOC_Os03g13670.1	intron_variant ; MODIFIER	silent_mutation	Average:14.681; most accessible tissue: Callus, score: 31.305	N	N	N	N
vg0307393257	T -> DEL	N	N	silent_mutation	Average:14.681; most accessible tissue: Callus, score: 31.305	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0307393257	NA	5.29E-15	mr1276	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307393257	NA	2.34E-15	mr1324	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307393257	NA	2.86E-13	mr1335	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307393257	NA	4.03E-11	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307393257	NA	4.87E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307393257	2.35E-06	NA	mr1879	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307393257	NA	9.60E-17	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307393257	NA	4.10E-14	mr1333_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307393257	NA	4.93E-21	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251