Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307039146:

Variant ID: vg0307039146 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 7039146
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, C: 0.13, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

AGCTAACTGCACACAAACTCTAAAAAATATGCATTAAATTCATGGTGAGAGAGAGAGAGGATGAAGAAAATAAAGATAACCTTATAGCCAACATACTATA[T/C]
ATGTTAGCTTTAACATTAACTAATAGTAAGTAGTGAGCTCTACTATTAAACTTGCTCTAACCCCCCCCCCCCCCCGGCTAAAATACTCCAATTGGTAGTG

Reverse complement sequence

CACTACCAATTGGAGTATTTTAGCCGGGGGGGGGGGGGGGTTAGAGCAAGTTTAATAGTAGAGCTCACTACTTACTATTAGTTAATGTTAAAGCTAACAT[A/G]
TATAGTATGTTGGCTATAAGGTTATCTTTATTTTCTTCATCCTCTCTCTCTCTCACCATGAATTTAATGCATATTTTTTAGAGTTTGTGTGCAGTTAGCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.90%	1.50%	4.51%	33.05%	NA
All Indica	2759	39.50%	2.30%	6.49%	51.72%	NA
All Japonica	1512	99.30%	0.00%	0.13%	0.60%	NA
Aus	269	76.60%	1.50%	5.95%	15.99%	NA
Indica I	595	26.90%	1.00%	2.35%	69.75%	NA
Indica II	465	18.10%	0.60%	5.16%	76.13%	NA
Indica III	913	58.20%	4.20%	11.94%	25.74%	NA
Indica Intermediate	786	39.90%	2.20%	4.07%	53.82%	NA
Temperate Japonica	767	98.80%	0.00%	0.26%	0.91%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.00%	0.00%	0.83%	NA
VI/Aromatic	96	21.90%	3.10%	14.58%	60.42%	NA
Intermediate	90	68.90%	1.10%	2.22%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0307039146	T -> C	LOC_Os03g13020.1	downstream_gene_variant ; 2601.0bp to feature; MODIFIER	silent_mutation	Average:78.82; most accessible tissue: Zhenshan97 flower, score: 91.289	N	N	N	N
vg0307039146	T -> C	LOC_Os03g13030.1	downstream_gene_variant ; 4501.0bp to feature; MODIFIER	silent_mutation	Average:78.82; most accessible tissue: Zhenshan97 flower, score: 91.289	N	N	N	N
vg0307039146	T -> C	LOC_Os03g13030.2	downstream_gene_variant ; 4125.0bp to feature; MODIFIER	silent_mutation	Average:78.82; most accessible tissue: Zhenshan97 flower, score: 91.289	N	N	N	N
vg0307039146	T -> C	LOC_Os03g13020-LOC_Os03g13030	intergenic_region ; MODIFIER	silent_mutation	Average:78.82; most accessible tissue: Zhenshan97 flower, score: 91.289	N	N	N	N
vg0307039146	T -> DEL	N	N	silent_mutation	Average:78.82; most accessible tissue: Zhenshan97 flower, score: 91.289	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0307039146	NA	1.76E-24	mr1168	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307039146	NA	1.40E-26	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307039146	NA	5.77E-18	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307039146	NA	3.96E-08	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307039146	NA	7.72E-12	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307039146	NA	4.61E-20	mr1383_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307039146	NA	1.19E-24	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307039146	NA	1.12E-22	mr1682_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251