Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0306403146:

Variant ID: vg0306403146 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 6403146
Reference Allele: CAlternative Allele: G,CA
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAAGTACATGGAAGGTCCCTCAACTTGTCATCGAGTTATAAAATCGTCCCCAACCATAAAAACAGATATATGACATCTCTTAACTAATGAAAACCGGT[C/G,CA]
ACAATAGGTCCTTCGGTGGTTTTGACCCCGGTTTATTCTAGGTGACGGCTGAATCAGCGTGTGATCCATGTGAGCCCTACATATAAGGATGCCATATCGG

Reverse complement sequence

CCGATATGGCATCCTTATATGTAGGGCTCACATGGATCACACGCTGATTCAGCCGTCACCTAGAATAAACCGGGGTCAAAACCACCGAAGGACCTATTGT[G/C,TG]
ACCGGTTTTCATTAGTTAAGAGATGTCATATATCTGTTTTTATGGTTGGGGACGATTTTATAACTCGATGACAAGTTGAGGGACCTTCCATGTACTTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.10% 3.90% 1.95% 0.00% CA: 0.02%
All Indica  2759 90.00% 6.70% 3.23% 0.00% CA: 0.04%
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 72.80% 18.50% 8.74% 0.00% NA
Indica II  465 94.00% 2.40% 3.66% 0.00% NA
Indica III  913 99.90% 0.00% 0.00% 0.00% CA: 0.11%
Indica Intermediate  786 89.20% 8.30% 2.54% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0306403146 C -> CA LOC_Os03g12210.1 upstream_gene_variant ; 88.0bp to feature; MODIFIER silent_mutation Average:98.4; most accessible tissue: Zhenshan97 panicle, score: 99.409 N N N N
vg0306403146 C -> CA LOC_Os03g12200.1 downstream_gene_variant ; 1842.0bp to feature; MODIFIER silent_mutation Average:98.4; most accessible tissue: Zhenshan97 panicle, score: 99.409 N N N N
vg0306403146 C -> CA LOC_Os03g12200-LOC_Os03g12210 intergenic_region ; MODIFIER silent_mutation Average:98.4; most accessible tissue: Zhenshan97 panicle, score: 99.409 N N N N
vg0306403146 C -> G LOC_Os03g12210.1 upstream_gene_variant ; 89.0bp to feature; MODIFIER silent_mutation Average:98.4; most accessible tissue: Zhenshan97 panicle, score: 99.409 N N N N
vg0306403146 C -> G LOC_Os03g12200.1 downstream_gene_variant ; 1841.0bp to feature; MODIFIER silent_mutation Average:98.4; most accessible tissue: Zhenshan97 panicle, score: 99.409 N N N N
vg0306403146 C -> G LOC_Os03g12200-LOC_Os03g12210 intergenic_region ; MODIFIER silent_mutation Average:98.4; most accessible tissue: Zhenshan97 panicle, score: 99.409 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0306403146 C CA 0.04 0.09 0.06 0.02 0.02 0.03
vg0306403146 C G -0.03 -0.03 -0.01 -0.03 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0306403146 NA 7.21E-06 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 5.99E-07 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 8.45E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 8.72E-07 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 9.00E-09 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 1.28E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 2.05E-06 mr1553 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 1.61E-06 mr1706 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 1.25E-11 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 2.86E-10 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 8.38E-08 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 2.23E-08 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 1.43E-07 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 1.37E-07 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 1.33E-07 mr1359_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 3.08E-08 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 3.66E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 6.81E-07 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 2.79E-07 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 2.50E-11 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 1.40E-10 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 9.66E-07 mr1520_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 8.24E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 8.68E-10 mr1968_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 3.48E-07 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306403146 NA 5.94E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251