Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0306155502:

Variant ID: vg0306155502 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 6155502
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCCGTGTCCAACTTTGACTGTCCGTCTTATATGAAATTTTTTTATAATTCGTATTTTTCATTGTTTGTTAGATGATAAAACATTATTAATATTTTATGC[G/A]
TAACTTGTCTTTTTATTTTTTTTCATAATTTTTTCAAATAAGACGGACGGTCAAACGTTGGGCACGGAAACCAGTGTTTGTCTTTTTTTTGGACGGAGGG

Reverse complement sequence

CCCTCCGTCCAAAAAAAAGACAAACACTGGTTTCCGTGCCCAACGTTTGACCGTCCGTCTTATTTGAAAAAATTATGAAAAAAAATAAAAAGACAAGTTA[C/T]
GCATAAAATATTAATAATGTTTTATCATCTAACAAACAATGAAAAATACGAATTATAAAAAAATTTCATATAAGACGGACAGTCAAAGTTGGACACGGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.80%	8.90%	0.17%	0.08%	NA
All Indica	2759	93.60%	6.00%	0.29%	0.14%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	15.20%	84.80%	0.00%	0.00%	NA
Indica I	595	99.20%	0.20%	0.50%	0.17%	NA
Indica II	465	87.70%	12.00%	0.22%	0.00%	NA
Indica III	913	95.40%	4.50%	0.00%	0.11%	NA
Indica Intermediate	786	90.70%	8.50%	0.51%	0.25%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	78.10%	21.90%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0306155502	G -> A	LOC_Os03g11770.1	upstream_gene_variant ; 4446.0bp to feature; MODIFIER	silent_mutation	Average:60.664; most accessible tissue: Callus, score: 93.699	N	N	N	N
vg0306155502	G -> A	LOC_Os03g11760.1	downstream_gene_variant ; 319.0bp to feature; MODIFIER	silent_mutation	Average:60.664; most accessible tissue: Callus, score: 93.699	N	N	N	N
vg0306155502	G -> A	LOC_Os03g11760-LOC_Os03g11770	intergenic_region ; MODIFIER	silent_mutation	Average:60.664; most accessible tissue: Callus, score: 93.699	N	N	N	N
vg0306155502	G -> DEL	N	N	silent_mutation	Average:60.664; most accessible tissue: Callus, score: 93.699	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0306155502	NA	1.85E-09	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	1.70E-06	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	3.24E-07	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	6.05E-06	mr1122	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	1.63E-08	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	1.21E-09	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	1.91E-12	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	6.44E-08	mr1684	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	4.49E-11	mr1722	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	6.43E-09	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	4.68E-06	mr1808	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	5.53E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	1.51E-07	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	1.83E-07	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	3.74E-11	mr1193_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	5.54E-09	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	3.24E-06	mr1291_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	4.97E-06	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	6.32E-09	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	2.15E-07	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	1.71E-09	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	1.23E-08	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	7.22E-10	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502	NA	4.29E-06	mr1892_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251