Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0306112666:

Variant ID: vg0306112666 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 6112666
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


GTCTCTATTTACATGATATATATCATTACTACATTTTTCTTATACAGAATGGCTATATATAATTAATATAAATATTAATTAAACTTAAAAAAGAAAATCT[C/T]
ATAGTATCCCGATACTACGATACGATCCTACGATACGATATTACTTTGAGCAGAACTATGCTAGTATCGTGATCCTAGCAACCTTGGCAGCTGCGCGAGC

Reverse complement sequence

GCTCGCGCAGCTGCCAAGGTTGCTAGGATCACGATACTAGCATAGTTCTGCTCAAAGTAATATCGTATCGTAGGATCGTATCGTAGTATCGGGATACTAT[G/A]
AGATTTTCTTTTTTAAGTTTAATTAATATTTATATTAATTATATATAGCCATTCTGTATAAGAAAAATGTAGTAATGATATATATCATGTAAATAGAGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.40% 22.50% 0.19% 0.00% NA
All Indica  2759 74.10% 25.60% 0.29% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 0.40% 99.30% 0.37% 0.00% NA
Indica I  595 50.60% 49.10% 0.34% 0.00% NA
Indica II  465 87.10% 12.90% 0.00% 0.00% NA
Indica III  913 82.80% 16.60% 0.55% 0.00% NA
Indica Intermediate  786 74.00% 25.80% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 31.20% 68.80% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0306112666 C -> T LOC_Os03g11690.1 upstream_gene_variant ; 2672.0bp to feature; MODIFIER silent_mutation Average:64.263; most accessible tissue: Minghui63 panicle, score: 90.408 N N N N
vg0306112666 C -> T LOC_Os03g11690.2 upstream_gene_variant ; 2672.0bp to feature; MODIFIER silent_mutation Average:64.263; most accessible tissue: Minghui63 panicle, score: 90.408 N N N N
vg0306112666 C -> T LOC_Os03g11680-LOC_Os03g11690 intergenic_region ; MODIFIER silent_mutation Average:64.263; most accessible tissue: Minghui63 panicle, score: 90.408 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0306112666 C T 0.01 -0.01 -0.01 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0306112666 NA 2.64E-06 mr1115 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306112666 NA 3.51E-06 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306112666 NA 1.44E-07 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306112666 4.61E-06 3.00E-09 mr1376 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306112666 4.61E-06 3.00E-09 mr1431 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306112666 NA 2.41E-06 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306112666 NA 1.88E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306112666 NA 6.79E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306112666 NA 7.01E-10 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306112666 NA 4.97E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306112666 NA 3.92E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306112666 NA 1.94E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306112666 NA 9.14E-07 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306112666 NA 1.62E-08 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306112666 NA 1.67E-08 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306112666 NA 1.28E-06 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251