Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0305333401:

Variant ID: vg0305333401 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 5333401
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

GCATATATGCAACTCTACAAAATCTTAAGTCCAAACTCAACTCACACGTCGAGATATAAAAAAGACAAATTCAGCGTATGAATAGTAGCGTACTGTTTAT[A/G]
TCTAAATTTGTCTTTTTTGTTTCTCGATGTGTAGATCGAATTTGAACATGAATTTTGGTGGACTAGTAGGTATCATTATACTCTATATTGTTAATTTTTT

Reverse complement sequence

AAAAAATTAACAATATAGAGTATAATGATACCTACTAGTCCACCAAAATTCATGTTCAAATTCGATCTACACATCGAGAAACAAAAAAGACAAATTTAGA[T/C]
ATAAACAGTACGCTACTATTCATACGCTGAATTTGTCTTTTTTATATCTCGACGTGTGAGTTGAGTTTGGACTTAAGATTTTGTAGAGTTGCATATATGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.20%	17.70%	0.13%	0.00%	NA
All Indica	2759	98.80%	1.20%	0.00%	0.00%	NA
All Japonica	1512	48.90%	50.70%	0.40%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	96.10%	3.90%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.20%	1.80%	0.00%	0.00%	NA
Temperate Japonica	767	80.80%	18.50%	0.65%	0.00%	NA
Tropical Japonica	504	9.30%	90.70%	0.00%	0.00%	NA
Japonica Intermediate	241	29.90%	69.70%	0.41%	0.00%	NA
VI/Aromatic	96	87.50%	12.50%	0.00%	0.00%	NA
Intermediate	90	75.60%	24.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0305333401	A -> G	LOC_Os03g10469.1	upstream_gene_variant ; 2806.0bp to feature; MODIFIER	silent_mutation	Average:52.271; most accessible tissue: Zhenshan97 flower, score: 85.053	N	N	N	N
vg0305333401	A -> G	LOC_Os03g10469.2	upstream_gene_variant ; 2806.0bp to feature; MODIFIER	silent_mutation	Average:52.271; most accessible tissue: Zhenshan97 flower, score: 85.053	N	N	N	N
vg0305333401	A -> G	LOC_Os03g10478.1	intron_variant ; MODIFIER	silent_mutation	Average:52.271; most accessible tissue: Zhenshan97 flower, score: 85.053	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0305333401	NA	6.09E-08	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305333401	6.19E-08	5.25E-10	mr1602	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305333401	NA	5.94E-07	mr1602	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305333401	NA	4.95E-12	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305333401	NA	1.99E-11	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305333401	NA	6.82E-09	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305333401	NA	1.05E-09	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305333401	NA	3.16E-08	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305333401	NA	6.36E-06	mr1923_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251