Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0305036157:

Variant ID: vg0305036157 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 5036157
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTGCTCTCTCTCTTCATTTAATCTCTTCTAAGTAAGAAAATATGCTGACATGGATATCTTGTAGAGAGCCTATAGATAACCATTGCGGGTGCCCTTAT[G/A]
ATGTCTTGGATATTGTGTAGAAACCATATCTCATGCAAGATCTGGTTTTCTTCTTTTTTTTCTCATTTATTCACTTGCCACATCATCTTTCATTCTAGGT

Reverse complement sequence

ACCTAGAATGAAAGATGATGTGGCAAGTGAATAAATGAGAAAAAAAAGAAGAAAACCAGATCTTGCATGAGATATGGTTTCTACACAATATCCAAGACAT[C/T]
ATAAGGGCACCCGCAATGGTTATCTATAGGCTCTCTACAAGATATCCATGTCAGCATATTTTCTTACTTAGAAGAGATTAAATGAAGAGAGAGAGCAAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.10% 9.90% 0.00% 0.00% NA
All Indica  2759 94.60% 5.40% 0.00% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 5.20% 94.80% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 87.70% 12.30% 0.00% 0.00% NA
Indica III  913 96.80% 3.20% 0.00% 0.00% NA
Indica Intermediate  786 92.00% 8.00% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 49.00% 51.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0305036157 G -> A LOC_Os03g10030.1 intron_variant ; MODIFIER silent_mutation Average:66.414; most accessible tissue: Minghui63 flower, score: 93.183 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0305036157 G A -0.04 -0.08 -0.06 -0.04 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0305036157 NA 1.16E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305036157 NA 7.15E-15 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305036157 NA 9.93E-19 mr1231 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305036157 NA 2.79E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305036157 NA 3.68E-24 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305036157 NA 7.57E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305036157 NA 1.73E-06 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305036157 NA 5.47E-19 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305036157 NA 1.73E-06 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305036157 NA 1.79E-08 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305036157 NA 1.70E-24 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305036157 NA 4.71E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305036157 NA 6.93E-20 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305036157 NA 9.19E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305036157 NA 2.52E-10 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305036157 NA 2.40E-22 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305036157 NA 1.03E-19 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305036157 NA 1.20E-07 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305036157 NA 1.48E-15 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251