Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304891426:

Variant ID: vg0304891426 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 4891426
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

AAACCCTTGAGGCAAGTATATGTTTGAAAGATTGGATAATTGGATTTGACGATGATGAAAAAGGTAAAAGATTGACATTATGTAAGGGTATGTATTATAG[C/A]
ATATACTTGATCTCATTTCTTGTGCTTCAATATGCAGGCTATGCAACAGAAGGATCTCGCATTTGTGATTTGGAAGACTATGTTGAATAGTTAAATGCTG

Reverse complement sequence

CAGCATTTAACTATTCAACATAGTCTTCCAAATCACAAATGCGAGATCCTTCTGTTGCATAGCCTGCATATTGAAGCACAAGAAATGAGATCAAGTATAT[G/T]
CTATAATACATACCCTTACATAATGTCAATCTTTTACCTTTTTCATCATCGTCAAATCCAATTATCCAATCTTTCAAACATATACTTGCCTCAAGGGTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.60%	18.30%	0.04%	3.03%	NA
All Indica	2759	65.30%	31.00%	0.04%	3.73%	NA
All Japonica	1512	99.90%	0.00%	0.00%	0.07%	NA
Aus	269	94.10%	1.50%	0.00%	4.46%	NA
Indica I	595	30.60%	69.20%	0.17%	0.00%	NA
Indica II	465	95.90%	3.90%	0.00%	0.22%	NA
Indica III	913	67.40%	22.80%	0.00%	9.86%	NA
Indica Intermediate	786	71.00%	27.50%	0.00%	1.53%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	69.80%	3.10%	1.04%	26.04%	NA
Intermediate	90	92.20%	5.60%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0304891426	C -> A	LOC_Os03g09820.1	downstream_gene_variant ; 4112.0bp to feature; MODIFIER	silent_mutation	Average:32.932; most accessible tissue: Minghui63 root, score: 56.226	N	N	N	N
vg0304891426	C -> A	LOC_Os03g09840.1	downstream_gene_variant ; 3096.0bp to feature; MODIFIER	silent_mutation	Average:32.932; most accessible tissue: Minghui63 root, score: 56.226	N	N	N	N
vg0304891426	C -> A	LOC_Os03g09840.2	downstream_gene_variant ; 3097.0bp to feature; MODIFIER	silent_mutation	Average:32.932; most accessible tissue: Minghui63 root, score: 56.226	N	N	N	N
vg0304891426	C -> A	LOC_Os03g09830.2	intron_variant ; MODIFIER	silent_mutation	Average:32.932; most accessible tissue: Minghui63 root, score: 56.226	N	N	N	N
vg0304891426	C -> DEL	N	N	silent_mutation	Average:32.932; most accessible tissue: Minghui63 root, score: 56.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0304891426	NA	1.37E-06	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304891426	NA	3.60E-06	mr1274	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304891426	NA	1.72E-10	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304891426	NA	1.07E-18	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304891426	NA	8.35E-07	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304891426	NA	1.19E-06	mr1233_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304891426	NA	1.48E-31	mr1598_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304891426	NA	2.36E-10	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251