Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304420874:

Variant ID: vg0304420874 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 4420874
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

TTGATAAACTTGTTTTCTCACTTCTTCGGTCATGTCTTTCCTTCCTTCGATGGTTTACTTCAACGAGAGCCATGACATGTTCTAGCAAAAGGAAGAAAAT[C/A]
AAGTTCATTGATAGTACAAATAGCCATGGCATGTTCTAGCAAAATCTAATTGTATCAAAAAGAAGTTGGCTTACCAGCAAGGTGTTGTACATAATCGAAA

Reverse complement sequence

TTTCGATTATGTACAACACCTTGCTGGTAAGCCAACTTCTTTTTGATACAATTAGATTTTGCTAGAACATGCCATGGCTATTTGTACTATCAATGAACTT[G/T]
ATTTTCTTCCTTTTGCTAGAACATGTCATGGCTCTCGTTGAAGTAAACCATCGAAGGAAGGAAAGACATGACCGAAGAAGTGAGAAAACAAGTTTATCAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.20%	45.60%	0.25%	0.00%	NA
All Indica	2759	22.80%	76.70%	0.43%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	12.30%	87.60%	0.17%	0.00%	NA
Indica II	465	13.10%	86.90%	0.00%	0.00%	NA
Indica III	913	31.00%	68.50%	0.55%	0.00%	NA
Indica Intermediate	786	27.10%	72.10%	0.76%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0304420874	C -> A	LOC_Os03g08590.1	upstream_gene_variant ; 1492.0bp to feature; MODIFIER	silent_mutation	Average:19.981; most accessible tissue: Zhenshan97 flower, score: 27.882	N	N	N	N
vg0304420874	C -> A	LOC_Os03g08580.1	downstream_gene_variant ; 1757.0bp to feature; MODIFIER	silent_mutation	Average:19.981; most accessible tissue: Zhenshan97 flower, score: 27.882	N	N	N	N
vg0304420874	C -> A	LOC_Os03g08580.3	downstream_gene_variant ; 1757.0bp to feature; MODIFIER	silent_mutation	Average:19.981; most accessible tissue: Zhenshan97 flower, score: 27.882	N	N	N	N
vg0304420874	C -> A	LOC_Os03g08580.2	downstream_gene_variant ; 1757.0bp to feature; MODIFIER	silent_mutation	Average:19.981; most accessible tissue: Zhenshan97 flower, score: 27.882	N	N	N	N
vg0304420874	C -> A	LOC_Os03g08590-LOC_Os03g08600	intergenic_region ; MODIFIER	silent_mutation	Average:19.981; most accessible tissue: Zhenshan97 flower, score: 27.882	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0304420874	NA	3.59E-12	mr1169	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304420874	NA	1.45E-11	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304420874	7.22E-06	1.11E-07	mr1400_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304420874	NA	6.07E-14	mr1454_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304420874	NA	1.35E-06	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251