| Variant ID: vg0304141111 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 4141111 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATACTCCCTCTGTCCCATAAAAACGAATCTAGAATCGGATGTGACATATTCTAGTACTACGAATCTAAACAAATGTATGTCCCATTCATAGTAGGGGCAT[C/T,A]
TGCAAATTTGCCACCGGTTTTTTCAATTTTGCAAGAATACCACCCGAATGATAGTTTTAGTGATATTTTTGTAATTTTCTAGTGACAGTCTTACAATAAC
GTTATTGTAAGACTGTCACTAGAAAATTACAAAAATATCACTAAAACTATCATTCGGGTGGTATTCTTGCAAAATTGAAAAAACCGGTGGCAAATTTGCA[G/A,T]
ATGCCCCTACTATGAATGGGACATACATTTGTTTAGATTCGTAGTACTAGAATATGTCACATCCGATTCTAGATTCGTTTTTATGGGACAGAGGGAGTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 99.20% | 0.70% | 0.06% | 0.00% | A: 0.06% |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 97.50% | 2.10% | 0.20% | 0.00% | A: 0.20% |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.40% | 4.20% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.00% | 0.00% | A: 0.60% |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0304141111 | C -> T | LOC_Os03g08100.1 | upstream_gene_variant ; 4621.0bp to feature; MODIFIER | silent_mutation | Average:49.393; most accessible tissue: Minghui63 flower, score: 77.232 | N | N | N | N |
| vg0304141111 | C -> T | LOC_Os03g08100.2 | upstream_gene_variant ; 4621.0bp to feature; MODIFIER | silent_mutation | Average:49.393; most accessible tissue: Minghui63 flower, score: 77.232 | N | N | N | N |
| vg0304141111 | C -> T | LOC_Os03g08114.1 | downstream_gene_variant ; 2909.0bp to feature; MODIFIER | silent_mutation | Average:49.393; most accessible tissue: Minghui63 flower, score: 77.232 | N | N | N | N |
| vg0304141111 | C -> T | LOC_Os03g08114.2 | downstream_gene_variant ; 5000.0bp to feature; MODIFIER | silent_mutation | Average:49.393; most accessible tissue: Minghui63 flower, score: 77.232 | N | N | N | N |
| vg0304141111 | C -> T | LOC_Os03g08110.1 | intron_variant ; MODIFIER | silent_mutation | Average:49.393; most accessible tissue: Minghui63 flower, score: 77.232 | N | N | N | N |
| vg0304141111 | C -> A | LOC_Os03g08100.1 | upstream_gene_variant ; 4621.0bp to feature; MODIFIER | silent_mutation | Average:49.393; most accessible tissue: Minghui63 flower, score: 77.232 | N | N | N | N |
| vg0304141111 | C -> A | LOC_Os03g08100.2 | upstream_gene_variant ; 4621.0bp to feature; MODIFIER | silent_mutation | Average:49.393; most accessible tissue: Minghui63 flower, score: 77.232 | N | N | N | N |
| vg0304141111 | C -> A | LOC_Os03g08114.1 | downstream_gene_variant ; 2909.0bp to feature; MODIFIER | silent_mutation | Average:49.393; most accessible tissue: Minghui63 flower, score: 77.232 | N | N | N | N |
| vg0304141111 | C -> A | LOC_Os03g08114.2 | downstream_gene_variant ; 5000.0bp to feature; MODIFIER | silent_mutation | Average:49.393; most accessible tissue: Minghui63 flower, score: 77.232 | N | N | N | N |
| vg0304141111 | C -> A | LOC_Os03g08110.1 | intron_variant ; MODIFIER | silent_mutation | Average:49.393; most accessible tissue: Minghui63 flower, score: 77.232 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0304141111 | NA | 1.28E-06 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304141111 | NA | 1.68E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304141111 | 3.31E-07 | 3.31E-07 | mr1284 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304141111 | NA | 1.52E-07 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304141111 | NA | 4.47E-08 | mr1358 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304141111 | NA | 5.29E-06 | mr1379 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304141111 | 1.60E-06 | 5.54E-07 | mr1397 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304141111 | NA | 7.94E-06 | mr1515 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304141111 | NA | 1.16E-09 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304141111 | NA | 6.76E-07 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304141111 | 6.07E-06 | 6.07E-06 | mr1587 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304141111 | 8.26E-06 | 8.26E-06 | mr1967 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304141111 | 8.22E-06 | 8.22E-06 | mr1992 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304141111 | NA | 2.36E-07 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304141111 | NA | 5.77E-09 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |