Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0303350062:

Variant ID: vg0303350062 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 3350062
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGTGACAAATATGAATCATAGCAATCCTTAAAATAAATAGAGGACTTATTTACCTTAACTTAGGTTGCAGCTCAGACAGCCCGAGAATACAACCGACGAC[G/A]
CGGATGAGGAAACACCAACAGCAGCAGCAGCAGCAGCGGAACCAACGGTCTAACACCCAACACCACAGGCGACGGCTGGGAACCAGGACGAAACCCTAAT

Reverse complement sequence

ATTAGGGTTTCGTCCTGGTTCCCAGCCGTCGCCTGTGGTGTTGGGTGTTAGACCGTTGGTTCCGCTGCTGCTGCTGCTGCTGTTGGTGTTTCCTCATCCG[C/T]
GTCGTCGGTTGTATTCTCGGGCTGTCTGAGCTGCAACCTAAGTTAAGGTAAATAAGTCCTCTATTTATTTTAAGGATTGCTATGATTCATATTTGTCACC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.10%	0.30%	2.18%	0.38%	NA
All Indica	2759	96.00%	0.50%	2.86%	0.65%	NA
All Japonica	1512	99.90%	0.00%	0.07%	0.00%	NA
Aus	269	99.30%	0.40%	0.37%	0.00%	NA
Indica I	595	97.30%	0.70%	1.85%	0.17%	NA
Indica II	465	97.00%	0.00%	2.37%	0.65%	NA
Indica III	913	95.10%	0.90%	3.40%	0.66%	NA
Indica Intermediate	786	95.50%	0.10%	3.31%	1.02%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	77.10%	0.00%	22.92%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0303350062	G -> A	LOC_Os03g06654.1	upstream_gene_variant ; 4979.0bp to feature; MODIFIER	silent_mutation	Average:37.718; most accessible tissue: Minghui63 root, score: 59.984	N	N	N	N
vg0303350062	G -> A	LOC_Os03g06654.2	upstream_gene_variant ; 4979.0bp to feature; MODIFIER	silent_mutation	Average:37.718; most accessible tissue: Minghui63 root, score: 59.984	N	N	N	N
vg0303350062	G -> A	LOC_Os03g06640.1	intron_variant ; MODIFIER	silent_mutation	Average:37.718; most accessible tissue: Minghui63 root, score: 59.984	N	N	N	N
vg0303350062	G -> DEL	N	N	silent_mutation	Average:37.718; most accessible tissue: Minghui63 root, score: 59.984	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0303350062	5.32E-06	8.04E-06	mr1358_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303350062	NA	8.40E-06	mr1469_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303350062	3.20E-07	3.20E-07	mr1967_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251