Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0301256734:

Variant ID: vg0301256734 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 1256734
Reference Allele: TAlternative Allele: G,TAG
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATCATCTAACAACAATGAAAATACGAATTATAAAAAAAAATTATATAAGACAGACAATCAAAGTTGAACATAGAAATCCAGAGTTTGCCTTTTTTTAA[T/G,TAG]
TACAGAGGGAGTACATACTACTTCGTACTTTTTTTTAGAGAGAGAAACTACTCTATGTACTGTGTGTACCGTGTACGCTACTGTACTGCGGTTGGGATCT

Reverse complement sequence

AGATCCCAACCGCAGTACAGTAGCGTACACGGTACACACAGTACATAGAGTAGTTTCTCTCTCTAAAAAAAAGTACGAAGTAGTATGTACTCCCTCTGTA[A/C,CTA]
TTAAAAAAAGGCAAACTCTGGATTTCTATGTTCAACTTTGATTGTCTGTCTTATATAATTTTTTTTTATAATTCGTATTTTCATTGTTGTTAGATGATAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 18.40% 1.70% 2.58% 77.32% TAG: 0.06%
All Indica  2759 1.70% 2.80% 3.08% 92.46% TAG: 0.04%
All Japonica  1512 49.10% 0.00% 0.53% 50.33% NA
Aus  269 0.70% 0.70% 7.43% 91.08% NA
Indica I  595 0.50% 0.00% 6.05% 93.45% NA
Indica II  465 5.80% 8.00% 2.37% 83.87% NA
Indica III  913 0.10% 0.90% 0.55% 98.47% NA
Indica Intermediate  786 1.90% 3.90% 4.20% 89.82% TAG: 0.13%
Temperate Japonica  767 62.80% 0.00% 0.00% 37.16% NA
Tropical Japonica  504 42.10% 0.00% 0.60% 57.34% NA
Japonica Intermediate  241 20.30% 0.00% 2.07% 77.59% NA
VI/Aromatic  96 45.80% 0.00% 3.12% 51.04% NA
Intermediate  90 37.80% 0.00% 6.67% 53.33% TAG: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0301256734 T -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301256734 T -> G LOC_Os03g03050.1 downstream_gene_variant ; 2611.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301256734 T -> G LOC_Os03g03034-LOC_Os03g03050 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301256734 T -> TAG LOC_Os03g03050.1 downstream_gene_variant ; 2610.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301256734 T -> TAG LOC_Os03g03034-LOC_Os03g03050 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0301256734 T G -0.03 -0.02 -0.02 0.08 0.08 0.08
vg0301256734 T TAG -0.18 -0.35 -0.37 -0.02 -0.28 -0.32

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0301256734 NA 1.38E-08 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301256734 NA 5.06E-26 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301256734 NA 5.41E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301256734 NA 5.44E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301256734 NA 4.64E-15 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301256734 NA 2.89E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301256734 NA 5.21E-28 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301256734 NA 3.69E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301256734 4.75E-06 NA mr1858 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301256734 4.59E-06 NA mr1859 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301256734 NA 1.46E-23 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251