Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235782900:

Variant ID: vg0235782900 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 35782900
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.10, T: 0.01, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

CTAGCATTTCTCACATTGTTAATGAATCTAGACATATATATCTATCTAGATTTATTAACATCAATACGAATGTAGGAAATGTTAGAATGACTTACATTAT[A/G]
AAATGGAGGAAGTATTATATTATTTCAGTGGACTAAAACACTACGACAAAATTAAGAAGTAAGCAGTGTTCTTGTCACACCTTCTTCGAACACGCAAGAA

Reverse complement sequence

TTCTTGCGTGTTCGAAGAAGGTGTGACAAGAACACTGCTTACTTCTTAATTTTGTCGTAGTGTTTTAGTCCACTGAAATAATATAATACTTCCTCCATTT[T/C]
ATAATGTAAGTCATTCTAACATTTCCTACATTCGTATTGATGTTAATAAATCTAGATAGATATATATGTCTAGATTCATTAACAATGTGAGAAATGCTAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.70%	27.10%	0.19%	0.00%	NA
All Indica	2759	58.00%	41.80%	0.25%	0.00%	NA
All Japonica	1512	96.70%	3.30%	0.00%	0.00%	NA
Aus	269	78.10%	21.60%	0.37%	0.00%	NA
Indica I	595	23.20%	76.50%	0.34%	0.00%	NA
Indica II	465	56.80%	42.80%	0.43%	0.00%	NA
Indica III	913	78.60%	21.20%	0.11%	0.00%	NA
Indica Intermediate	786	60.90%	38.80%	0.25%	0.00%	NA
Temperate Japonica	767	95.00%	5.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	83.30%	15.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0235782900	A -> G	LOC_Os02g58530.1	downstream_gene_variant ; 1512.0bp to feature; MODIFIER	silent_mutation	Average:56.056; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0235782900	A -> G	LOC_Os02g58540.1	downstream_gene_variant ; 384.0bp to feature; MODIFIER	silent_mutation	Average:56.056; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0235782900	A -> G	LOC_Os02g58550.1	downstream_gene_variant ; 1942.0bp to feature; MODIFIER	silent_mutation	Average:56.056; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0235782900	A -> G	LOC_Os02g58550.2	downstream_gene_variant ; 2968.0bp to feature; MODIFIER	silent_mutation	Average:56.056; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0235782900	A -> G	LOC_Os02g58530-LOC_Os02g58540	intergenic_region ; MODIFIER	silent_mutation	Average:56.056; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0235782900	NA	2.60E-10	Heading_date	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0235782900	NA	2.11E-09	mr1125_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235782900	NA	7.06E-07	mr1924_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251