Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235593093:

Variant ID: vg0235593093 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 35593093
Reference Allele: G	Alternative Allele: A,GA
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCAATATCATATTCGTTTTCATTCCGAAAAATAATAATATCCGAACTCATTTCCGAATTCGAAAATTTCCGAATATATCCGACCGAAACTATCCGAATCC[G/A,GA]
AAAAAAGTCTGGTTGGATGGAAACTATTCGAATCACTTTCAACCCTACGCCACTACGCCAGACACCTGCTAGCTAACTGCAGTTCATTATCCGGTCTGAC

Reverse complement sequence

GTCAGACCGGATAATGAACTGCAGTTAGCTAGCAGGTGTCTGGCGTAGTGGCGTAGGGTTGAAAGTGATTCGAATAGTTTCCATCCAACCAGACTTTTTT[C/T,TC]
GGATTCGGATAGTTTCGGTCGGATATATTCGGAAATTTTCGAATTCGGAAATGAGTTCGGATATTATTATTTTTCGGAATGAAAACGAATATGATATTGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.30%	39.40%	0.21%	0.00%	GA: 0.02%
All Indica	2759	95.60%	4.20%	0.18%	0.00%	NA
All Japonica	1512	4.30%	95.70%	0.00%	0.00%	NA
Aus	269	34.60%	64.70%	0.74%	0.00%	NA
Indica I	595	97.30%	2.70%	0.00%	0.00%	NA
Indica II	465	97.60%	2.40%	0.00%	0.00%	NA
Indica III	913	97.40%	2.50%	0.11%	0.00%	NA
Indica Intermediate	786	91.00%	8.50%	0.51%	0.00%	NA
Temperate Japonica	767	5.90%	94.10%	0.00%	0.00%	NA
Tropical Japonica	504	2.40%	97.60%	0.00%	0.00%	NA
Japonica Intermediate	241	3.30%	96.70%	0.00%	0.00%	NA
VI/Aromatic	96	20.80%	78.10%	0.00%	0.00%	GA: 1.04%
Intermediate	90	40.00%	56.70%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0235593093	G -> A	LOC_Os02g58170.1	upstream_gene_variant ; 2520.0bp to feature; MODIFIER	silent_mutation	Average:50.763; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0235593093	G -> A	LOC_Os02g58150.1	downstream_gene_variant ; 3844.0bp to feature; MODIFIER	silent_mutation	Average:50.763; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0235593093	G -> A	LOC_Os02g58150-LOC_Os02g58170	intergenic_region ; MODIFIER	silent_mutation	Average:50.763; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0235593093	G -> GA	LOC_Os02g58170.1	upstream_gene_variant ; 2519.0bp to feature; MODIFIER	silent_mutation	Average:50.763; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0235593093	G -> GA	LOC_Os02g58150.1	downstream_gene_variant ; 3845.0bp to feature; MODIFIER	silent_mutation	Average:50.763; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0235593093	G -> GA	LOC_Os02g58150-LOC_Os02g58170	intergenic_region ; MODIFIER	silent_mutation	Average:50.763; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0235593093	4.38E-06	NA	mr1216_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235593093	4.03E-06	4.03E-06	mr1259_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235593093	NA	7.91E-23	mr1386_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235593093	NA	1.00E-12	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235593093	5.57E-06	5.57E-06	mr1710_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235593093	9.17E-07	9.17E-07	mr1852_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251