Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235590636:

Variant ID: vg0235590636 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 35590636
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

TTTCTGATTTTTTTTAATTTTTTAGCATGTTTTGAGTTTGAAAGTTTTTAAATTTTGAGTTGAAGATTTTCAAATCTGGATTTGAAAGTTTTCGAATCTC[G/A]
ATTTAAAATTTTCAAATCTTGATTTGAAAGTTTTCAAATCTCAAATTGAAAGTTTTTAATTTTTTTCAAATCTGGACTTGAAAGTTTTTGAATCTCTATT

Reverse complement sequence

AATAGAGATTCAAAAACTTTCAAGTCCAGATTTGAAAAAAATTAAAAACTTTCAATTTGAGATTTGAAAACTTTCAAATCAAGATTTGAAAATTTTAAAT[C/T]
GAGATTCGAAAACTTTCAAATCCAGATTTGAAAATCTTCAACTCAAAATTTAAAAACTTTCAAACTCAAAACATGCTAAAAAATTAAAAAAAATCAGAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.50%	3.20%	0.61%	56.71%	NA
All Indica	2759	4.20%	4.90%	0.87%	90.03%	NA
All Japonica	1512	95.60%	0.50%	0.07%	3.90%	NA
Aus	269	66.20%	1.90%	0.74%	31.23%	NA
Indica I	595	2.70%	4.70%	0.50%	92.10%	NA
Indica II	465	2.40%	5.40%	1.29%	90.97%	NA
Indica III	913	2.40%	4.90%	0.77%	91.89%	NA
Indica Intermediate	786	8.50%	4.70%	1.02%	85.75%	NA
Temperate Japonica	767	93.90%	0.70%	0.13%	5.35%	NA
Tropical Japonica	504	97.60%	0.20%	0.00%	2.18%	NA
Japonica Intermediate	241	96.70%	0.40%	0.00%	2.90%	NA
VI/Aromatic	96	80.20%	1.00%	0.00%	18.75%	NA
Intermediate	90	57.80%	1.10%	2.22%	38.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0235590636	G -> A	LOC_Os02g58170.1	upstream_gene_variant ; 4977.0bp to feature; MODIFIER	silent_mutation	Average:75.797; most accessible tissue: Zhenshan97 flag leaf, score: 92.126	N	N	N	N
vg0235590636	G -> A	LOC_Os02g58150.1	downstream_gene_variant ; 1387.0bp to feature; MODIFIER	silent_mutation	Average:75.797; most accessible tissue: Zhenshan97 flag leaf, score: 92.126	N	N	N	N
vg0235590636	G -> A	LOC_Os02g58150-LOC_Os02g58170	intergenic_region ; MODIFIER	silent_mutation	Average:75.797; most accessible tissue: Zhenshan97 flag leaf, score: 92.126	N	N	N	N
vg0235590636	G -> DEL	N	N	silent_mutation	Average:75.797; most accessible tissue: Zhenshan97 flag leaf, score: 92.126	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0235590636	NA	7.95E-58	mr1064_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235590636	1.65E-06	NA	mr1064_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235590636	NA	9.72E-38	mr1110_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251