Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235561608:

Variant ID: vg0235561608 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 35561608
Reference Allele: CAlternative Allele: CAAA,T,CAAAA
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTTTTTTCATCAACAGCAAGTATGTTGTACTCCTTCCGTCCCATAAAAAACAAATATAGTACCGGATGTGACACATTCTAGTACTATAAATCTAGA[C/CAAA,T,CAAAA]
AAACGTATGTCTAGATTCGTATTTTATAGGACGGAGGGAGTAGACTACATCACTCTATCTTCATAGAATTATGAACAGGTACGAACTACGTAGGAATTGT

Reverse complement sequence

ACAATTCCTACGTAGTTCGTACCTGTTCATAATTCTATGAAGATAGAGTGATGTAGTCTACTCCCTCCGTCCTATAAAATACGAATCTAGACATACGTTT[G/TTTG,A,TTTTG]
TCTAGATTTATAGTACTAGAATGTGTCACATCCGGTACTATATTTGTTTTTTATGGGACGGAAGGAGTACAACATACTTGCTGTTGATGAAAAAAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.10% 3.00% 0.13% 0.00% CAAA: 0.70%; CAAAA: 0.06%
All Indica  2759 97.10% 2.60% 0.14% 0.00% CAAA: 0.22%
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 69.50% 22.30% 0.37% 0.00% CAAA: 6.69%; CAAAA: 1.12%
Indica I  595 93.60% 5.90% 0.50% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 98.90% 0.70% 0.00% 0.00% CAAA: 0.44%
Indica Intermediate  786 96.70% 2.90% 0.13% 0.00% CAAA: 0.25%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 82.30% 7.30% 1.04% 0.00% CAAA: 9.38%
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235561608 C -> T LOC_Os02g58110.1 upstream_gene_variant ; 3069.0bp to feature; MODIFIER silent_mutation Average:68.752; most accessible tissue: Minghui63 flag leaf, score: 89.224 N N N N
vg0235561608 C -> T LOC_Os02g58090.1 downstream_gene_variant ; 2696.0bp to feature; MODIFIER silent_mutation Average:68.752; most accessible tissue: Minghui63 flag leaf, score: 89.224 N N N N
vg0235561608 C -> T LOC_Os02g58100.1 downstream_gene_variant ; 15.0bp to feature; MODIFIER silent_mutation Average:68.752; most accessible tissue: Minghui63 flag leaf, score: 89.224 N N N N
vg0235561608 C -> T LOC_Os02g58100-LOC_Os02g58110 intergenic_region ; MODIFIER silent_mutation Average:68.752; most accessible tissue: Minghui63 flag leaf, score: 89.224 N N N N
vg0235561608 C -> CAAA LOC_Os02g58110.1 upstream_gene_variant ; 3068.0bp to feature; MODIFIER silent_mutation Average:68.752; most accessible tissue: Minghui63 flag leaf, score: 89.224 N N N N
vg0235561608 C -> CAAA LOC_Os02g58090.1 downstream_gene_variant ; 2697.0bp to feature; MODIFIER silent_mutation Average:68.752; most accessible tissue: Minghui63 flag leaf, score: 89.224 N N N N
vg0235561608 C -> CAAA LOC_Os02g58100.1 downstream_gene_variant ; 16.0bp to feature; MODIFIER silent_mutation Average:68.752; most accessible tissue: Minghui63 flag leaf, score: 89.224 N N N N
vg0235561608 C -> CAAA LOC_Os02g58100-LOC_Os02g58110 intergenic_region ; MODIFIER silent_mutation Average:68.752; most accessible tissue: Minghui63 flag leaf, score: 89.224 N N N N
vg0235561608 C -> CAAAA LOC_Os02g58110.1 upstream_gene_variant ; 3068.0bp to feature; MODIFIER silent_mutation Average:68.752; most accessible tissue: Minghui63 flag leaf, score: 89.224 N N N N
vg0235561608 C -> CAAAA LOC_Os02g58090.1 downstream_gene_variant ; 2697.0bp to feature; MODIFIER silent_mutation Average:68.752; most accessible tissue: Minghui63 flag leaf, score: 89.224 N N N N
vg0235561608 C -> CAAAA LOC_Os02g58100.1 downstream_gene_variant ; 16.0bp to feature; MODIFIER silent_mutation Average:68.752; most accessible tissue: Minghui63 flag leaf, score: 89.224 N N N N
vg0235561608 C -> CAAAA LOC_Os02g58100-LOC_Os02g58110 intergenic_region ; MODIFIER silent_mutation Average:68.752; most accessible tissue: Minghui63 flag leaf, score: 89.224 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0235561608 C CAAA -0.12 -0.06 -0.12 -0.08 -0.12 -0.14
vg0235561608 C CAAAA -0.35 -0.12 -0.15 -0.09 -0.13 -0.16
vg0235561608 C T 0.09 0.02 0.0 0.0 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235561608 1.12E-06 NA mr1335_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251