Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235259448:

Variant ID: vg0235259448 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 35259448
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCAGTCTGGCTCGAAGCGCTTCGCCCAATCGTCGCCGATTGGCAAGGGTAACCCACTAACCCCATCACAATTTCTTAATTATTATCATCACAAATTGGTT[G/A]
TAGGCTGGTTTCTCAAGTCCAAAATTTTAGGAAGTTAGGGTTCTGAAATATGAAGTTTCTCCCAATTTCTGTTACATAAACATAAATTTATTCTTTCTAG

Reverse complement sequence

CTAGAAAGAATAAATTTATGTTTATGTAACAGAAATTGGGAGAAACTTCATATTTCAGAACCCTAACTTCCTAAAATTTTGGACTTGAGAAACCAGCCTA[C/T]
AACCAATTTGTGATGATAATAATTAAGAAATTGTGATGGGGTTAGTGGGTTACCCTTGCCAATCGGCGACGATTGGGCGAAGCGCTTCGAGCCAGACTGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.50%	29.20%	2.14%	0.23%	NA
All Indica	2759	93.10%	3.00%	3.48%	0.40%	NA
All Japonica	1512	25.30%	74.50%	0.20%	0.00%	NA
Aus	269	53.50%	45.70%	0.74%	0.00%	NA
Indica I	595	94.60%	3.20%	2.18%	0.00%	NA
Indica II	465	94.20%	2.20%	3.66%	0.00%	NA
Indica III	913	92.90%	2.80%	3.18%	1.10%	NA
Indica Intermediate	786	91.60%	3.60%	4.71%	0.13%	NA
Temperate Japonica	767	8.20%	91.50%	0.26%	0.00%	NA
Tropical Japonica	504	43.70%	56.30%	0.00%	0.00%	NA
Japonica Intermediate	241	41.10%	58.50%	0.41%	0.00%	NA
VI/Aromatic	96	89.60%	10.40%	0.00%	0.00%	NA
Intermediate	90	60.00%	40.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0235259448	G -> A	LOC_Os02g57540.1	upstream_gene_variant ; 1213.0bp to feature; MODIFIER	silent_mutation	Average:47.832; most accessible tissue: Minghui63 root, score: 77.29	N	N	N	N
vg0235259448	G -> A	LOC_Os02g57530.1	downstream_gene_variant ; 3405.0bp to feature; MODIFIER	silent_mutation	Average:47.832; most accessible tissue: Minghui63 root, score: 77.29	N	N	N	N
vg0235259448	G -> A	LOC_Os02g57550.1	downstream_gene_variant ; 1810.0bp to feature; MODIFIER	silent_mutation	Average:47.832; most accessible tissue: Minghui63 root, score: 77.29	N	N	N	N
vg0235259448	G -> A	LOC_Os02g57560.1	downstream_gene_variant ; 3718.0bp to feature; MODIFIER	silent_mutation	Average:47.832; most accessible tissue: Minghui63 root, score: 77.29	N	N	N	N
vg0235259448	G -> A	LOC_Os02g57530.2	downstream_gene_variant ; 3405.0bp to feature; MODIFIER	silent_mutation	Average:47.832; most accessible tissue: Minghui63 root, score: 77.29	N	N	N	N
vg0235259448	G -> A	LOC_Os02g57530.3	downstream_gene_variant ; 3405.0bp to feature; MODIFIER	silent_mutation	Average:47.832; most accessible tissue: Minghui63 root, score: 77.29	N	N	N	N
vg0235259448	G -> A	LOC_Os02g57530.4	downstream_gene_variant ; 3405.0bp to feature; MODIFIER	silent_mutation	Average:47.832; most accessible tissue: Minghui63 root, score: 77.29	N	N	N	N
vg0235259448	G -> A	LOC_Os02g57540-LOC_Os02g57550	intergenic_region ; MODIFIER	silent_mutation	Average:47.832; most accessible tissue: Minghui63 root, score: 77.29	N	N	N	N
vg0235259448	G -> DEL	N	N	silent_mutation	Average:47.832; most accessible tissue: Minghui63 root, score: 77.29	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0235259448	NA	2.45E-06	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235259448	3.62E-07	1.55E-38	mr1448	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235259448	NA	1.17E-63	mr1125_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235259448	NA	5.77E-09	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235259448	NA	7.48E-07	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251