Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235145813:

Variant ID: vg0235145813 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 35145813
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, A: 0.26, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCATTTCTCAGCAGGAGACCTTTGGATCTTGTTTGGGGAGTTTTTAGCGGCTGCAAGCTTCTCCTTGAATCTCAATCTCTTCTAAAGACCCAAACGGT[T/A]
CAGATTTTAAGAACATATGTCTATAAATTATAGAAAATGAACTAGAAATCAGTAGGTATGAGACTAAGATTTTTCAGATCCGCAGAAACTAGCTATCAAT

Reverse complement sequence

ATTGATAGCTAGTTTCTGCGGATCTGAAAAATCTTAGTCTCATACCTACTGATTTCTAGTTCATTTTCTATAATTTATAGACATATGTTCTTAAAATCTG[A/T]
ACCGTTTGGGTCTTTAGAAGAGATTGAGATTCAAGGAGAAGCTTGCAGCCGCTAAAAACTCCCCAAACAAGATCCAAAGGTCTCCTGCTGAGAAATGCAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.00% 33.50% 0.53% 0.00% NA
All Indica  2759 51.50% 47.70% 0.87% 0.00% NA
All Japonica  1512 98.20% 1.80% 0.00% 0.00% NA
Aus  269 46.50% 53.20% 0.37% 0.00% NA
Indica I  595 53.90% 45.00% 1.01% 0.00% NA
Indica II  465 79.80% 19.80% 0.43% 0.00% NA
Indica III  913 39.10% 60.50% 0.44% 0.00% NA
Indica Intermediate  786 47.20% 51.30% 1.53% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 97.60% 2.40% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.70% 0.00% 0.00% NA
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235145813 T -> A LOC_Os02g57360-LOC_Os02g57370 intergenic_region ; MODIFIER silent_mutation Average:78.122; most accessible tissue: Zhenshan97 panicle, score: 95.264 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0235145813 T A 0.0 0.01 0.01 0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235145813 NA 2.31E-06 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235145813 NA 9.47E-15 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235145813 NA 2.30E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235145813 NA 1.59E-07 mr1975 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235145813 NA 1.75E-06 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235145813 NA 4.38E-18 mr1995 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251