Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235126648:

Variant ID: vg0235126648 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 35126648
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTGGATAGTATTTCAGGGTCCTTTATGACTTATTTTCTCTGGAGAGCTCAAGTCGAGTGACACCAAGCGCCCCGCTATTGGCAGAAACATGGAGGCAGC[G/C]
GGACCGTGCCTTCAGAGCGATGTGCATACGTTTGGCATATGTGGATGGCATCTGACATTACTGGGACATTAGCGATGTATGAGCTCTAATCTAAGCAGAC

Reverse complement sequence

GTCTGCTTAGATTAGAGCTCATACATCGCTAATGTCCCAGTAATGTCAGATGCCATCCACATATGCCAAACGTATGCACATCGCTCTGAAGGCACGGTCC[C/G]
GCTGCCTCCATGTTTCTGCCAATAGCGGGGCGCTTGGTGTCACTCGACTTGAGCTCTCCAGAGAAAATAAGTCATAAAGGACCCTGAAATACTATCCAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.90% 32.80% 0.34% 0.00% NA
All Indica  2759 88.50% 11.00% 0.54% 0.00% NA
All Japonica  1512 26.50% 73.50% 0.00% 0.00% NA
Aus  269 65.10% 34.90% 0.00% 0.00% NA
Indica I  595 97.00% 2.90% 0.17% 0.00% NA
Indica II  465 98.70% 1.10% 0.22% 0.00% NA
Indica III  913 83.10% 16.20% 0.66% 0.00% NA
Indica Intermediate  786 82.20% 16.90% 0.89% 0.00% NA
Temperate Japonica  767 9.30% 90.70% 0.00% 0.00% NA
Tropical Japonica  504 43.30% 56.70% 0.00% 0.00% NA
Japonica Intermediate  241 46.50% 53.50% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 62.20% 36.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235126648 G -> C LOC_Os02g57340.1 3_prime_UTR_variant ; 2004.0bp to feature; MODIFIER silent_mutation Average:74.523; most accessible tissue: Minghui63 root, score: 85.36 N N N N
vg0235126648 G -> C LOC_Os02g57330.1 upstream_gene_variant ; 3903.0bp to feature; MODIFIER silent_mutation Average:74.523; most accessible tissue: Minghui63 root, score: 85.36 N N N N
vg0235126648 G -> C LOC_Os02g57350.1 upstream_gene_variant ; 4026.0bp to feature; MODIFIER silent_mutation Average:74.523; most accessible tissue: Minghui63 root, score: 85.36 N N N N
vg0235126648 G -> C LOC_Os02g57330.2 upstream_gene_variant ; 3903.0bp to feature; MODIFIER silent_mutation Average:74.523; most accessible tissue: Minghui63 root, score: 85.36 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0235126648 G C 0.0 -0.03 -0.02 -0.02 -0.06 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235126648 NA 4.57E-07 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235126648 1.82E-06 1.82E-06 mr1270 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235126648 2.30E-06 2.30E-06 mr1275 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235126648 8.98E-06 8.98E-06 mr1379 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235126648 NA 1.31E-07 mr1574 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235126648 NA 1.70E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235126648 NA 1.87E-06 mr1895 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235126648 NA 1.99E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235126648 NA 3.49E-06 mr1981 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235126648 NA 1.36E-07 mr1982 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251