Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235115897:

Variant ID: vg0235115897 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 35115897
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, C: 0.32, others allele: 0.00, population size: 38. )

Flanking Sequence (100 bp) in Reference Genome:


AGCACGGATTTGCCCACACTCAGCGTTGTTGCCTCCATTGTTCTGTTGCTAAAGCATCAAAAGCAACAAGTTTTAAAATAAAAAAGAATTATCGAGAATT[T/C]
GCGTGGCTGAAGCTAAAGCAACTACTTTTAAGAAAGAAAATAAATGACGAGAGTGAGGGAGTCAGAGTAAAGAAAAGGACTTGGTGTTGCTTCCTTTGAT

Reverse complement sequence

ATCAAAGGAAGCAACACCAAGTCCTTTTCTTTACTCTGACTCCCTCACTCTCGTCATTTATTTTCTTTCTTAAAAGTAGTTGCTTTAGCTTCAGCCACGC[A/G]
AATTCTCGATAATTCTTTTTTATTTTAAAACTTGTTGCTTTTGATGCTTTAGCAACAGAACAATGGAGGCAACAACGCTGAGTGTGGGCAAATCCGTGCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.80% 9.70% 1.54% 54.93% NA
All Indica  2759 12.50% 5.80% 2.36% 79.34% NA
All Japonica  1512 73.70% 9.80% 0.07% 16.40% NA
Aus  269 34.90% 27.10% 1.12% 36.80% NA
Indica I  595 6.20% 1.50% 1.01% 91.26% NA
Indica II  465 1.50% 3.40% 0.43% 94.62% NA
Indica III  913 17.10% 9.10% 3.50% 70.32% NA
Indica Intermediate  786 18.40% 6.60% 3.18% 71.76% NA
Temperate Japonica  767 91.00% 1.20% 0.00% 7.82% NA
Tropical Japonica  504 56.70% 8.30% 0.20% 34.72% NA
Japonica Intermediate  241 54.40% 40.20% 0.00% 5.39% NA
VI/Aromatic  96 7.30% 69.80% 2.08% 20.83% NA
Intermediate  90 40.00% 13.30% 2.22% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235115897 T -> DEL N N silent_mutation Average:66.071; most accessible tissue: Minghui63 flag leaf, score: 86.911 N N N N
vg0235115897 T -> C LOC_Os02g57310.1 5_prime_UTR_variant ; 63.0bp to feature; MODIFIER silent_mutation Average:66.071; most accessible tissue: Minghui63 flag leaf, score: 86.911 N N N N
vg0235115897 T -> C LOC_Os02g57330.1 downstream_gene_variant ; 4066.0bp to feature; MODIFIER silent_mutation Average:66.071; most accessible tissue: Minghui63 flag leaf, score: 86.911 N N N N
vg0235115897 T -> C LOC_Os02g57330.2 downstream_gene_variant ; 4066.0bp to feature; MODIFIER silent_mutation Average:66.071; most accessible tissue: Minghui63 flag leaf, score: 86.911 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0235115897 T C 0.02 0.0 -0.01 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235115897 NA 3.22E-07 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235115897 NA 2.47E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235115897 NA 2.97E-08 mr1166 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235115897 NA 8.39E-06 mr1229 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235115897 9.27E-06 9.27E-06 mr1379 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235115897 NA 5.17E-06 mr1509 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235115897 NA 6.65E-07 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235115897 NA 4.30E-06 mr1574 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235115897 8.69E-07 2.37E-08 mr1765 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235115897 NA 3.64E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235115897 NA 8.46E-06 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235115897 NA 7.54E-06 mr1982 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251