Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235108715:

Variant ID: vg0235108715 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 35108715
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.60, C: 0.40, others allele: 0.00, population size: 50. )

Flanking Sequence (100 bp) in Reference Genome:

CTCCGCTCGAGCGTGAGAGAAGGGAAGGAGCAACGTTGGGCTCGAGGAAAGGGAGAGAGAGAGAGAGAGCGGAAAGGTGGAGAAAAAAAAAGGAAAACTA[C/T]
ATTTTTGTGGACCCCACTTGAGGTACTGCATTGTGCAGCTTGTGCCTCTCAGTGTTCCTCAGCATATGTGGCAGCTCAGGTCCGGCATTTTAGGTGACGC

Reverse complement sequence

GCGTCACCTAAAATGCCGGACCTGAGCTGCCACATATGCTGAGGAACACTGAGAGGCACAAGCTGCACAATGCAGTACCTCAAGTGGGGTCCACAAAAAT[G/A]
TAGTTTTCCTTTTTTTTTCTCCACCTTTCCGCTCTCTCTCTCTCTCTCCCTTTCCTCGAGCCCAACGTTGCTCCTTCCCTTCTCTCACGCTCGAGCGGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.60%	7.30%	2.12%	56.05%	NA
All Indica	2759	13.40%	2.60%	3.19%	80.83%	NA
All Japonica	1512	74.20%	9.30%	0.46%	16.01%	NA
Aus	269	34.90%	24.50%	0.74%	39.78%	NA
Indica I	595	6.40%	0.20%	0.34%	93.11%	NA
Indica II	465	2.40%	2.60%	2.80%	92.26%	NA
Indica III	913	18.20%	4.30%	4.93%	72.62%	NA
Indica Intermediate	786	19.60%	2.50%	3.56%	74.30%	NA
Temperate Japonica	767	91.80%	1.00%	0.26%	6.91%	NA
Tropical Japonica	504	56.90%	7.70%	0.99%	34.33%	NA
Japonica Intermediate	241	54.40%	39.00%	0.00%	6.64%	NA
VI/Aromatic	96	9.40%	61.50%	1.04%	28.12%	NA
Intermediate	90	43.30%	6.70%	2.22%	47.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0235108715	C -> T	LOC_Os02g57305.1	downstream_gene_variant ; 114.0bp to feature; MODIFIER	silent_mutation	Average:54.367; most accessible tissue: Callus, score: 93.761	N	N	N	N
vg0235108715	C -> T	LOC_Os02g57310.1	downstream_gene_variant ; 4922.0bp to feature; MODIFIER	silent_mutation	Average:54.367; most accessible tissue: Callus, score: 93.761	N	N	N	N
vg0235108715	C -> T	LOC_Os02g57300-LOC_Os02g57305	intergenic_region ; MODIFIER	silent_mutation	Average:54.367; most accessible tissue: Callus, score: 93.761	N	N	N	N
vg0235108715	C -> DEL	N	N	silent_mutation	Average:54.367; most accessible tissue: Callus, score: 93.761	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0235108715	NA	4.45E-07	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108715	NA	7.14E-06	mr1229	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108715	9.62E-06	9.62E-06	mr1379	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108715	7.05E-06	7.04E-06	mr1393	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108715	NA	4.21E-06	mr1427	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108715	NA	4.52E-07	mr1509	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108715	NA	4.54E-07	mr1574	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108715	NA	3.17E-07	mr1982	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108715	NA	1.82E-06	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251