Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234925070:

Variant ID: vg0234925070 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 34925070
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTTACTATCATTTATCATTTTTTTATGTTTTATCGTTAAAAAAATTAGGTATAATTTATAATTTAGCATATTTTTATTAACTTTTTAATGAGTTAAATG[A/G]
CCAAATGTTATTTTATGAGTCAACAGTCTAAATCCTTCAAAAAAATCAGAGGTAATATATGTTGGGCCATAACCTTGACAGAAGTGTGGCCAATTTGGAA

Reverse complement sequence

TTCCAAATTGGCCACACTTCTGTCAAGGTTATGGCCCAACATATATTACCTCTGATTTTTTTGAAGGATTTAGACTGTTGACTCATAAAATAACATTTGG[T/C]
CATTTAACTCATTAAAAAGTTAATAAAAATATGCTAAATTATAAATTATACCTAATTTTTTTAACGATAAAACATAAAAAAATGATAAATGATAGTAAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.60%	30.40%	0.02%	0.00%	NA
All Indica	2759	99.00%	1.00%	0.00%	0.00%	NA
All Japonica	1512	19.40%	80.60%	0.00%	0.00%	NA
Aus	269	67.30%	32.70%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	98.80%	1.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.20%	1.80%	0.00%	0.00%	NA
Temperate Japonica	767	8.20%	91.80%	0.00%	0.00%	NA
Tropical Japonica	504	41.90%	58.10%	0.00%	0.00%	NA
Japonica Intermediate	241	8.30%	91.70%	0.00%	0.00%	NA
VI/Aromatic	96	29.20%	70.80%	0.00%	0.00%	NA
Intermediate	90	58.90%	40.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0234925070	A -> G	LOC_Os02g57020.1	upstream_gene_variant ; 301.0bp to feature; MODIFIER	silent_mutation	Average:90.827; most accessible tissue: Minghui63 flag leaf, score: 97.137	N	N	N	N
vg0234925070	A -> G	LOC_Os02g57030.1	upstream_gene_variant ; 1566.0bp to feature; MODIFIER	silent_mutation	Average:90.827; most accessible tissue: Minghui63 flag leaf, score: 97.137	N	N	N	N
vg0234925070	A -> G	LOC_Os02g57030.2	upstream_gene_variant ; 1566.0bp to feature; MODIFIER	silent_mutation	Average:90.827; most accessible tissue: Minghui63 flag leaf, score: 97.137	N	N	N	N
vg0234925070	A -> G	LOC_Os02g56990.1	downstream_gene_variant ; 4922.0bp to feature; MODIFIER	silent_mutation	Average:90.827; most accessible tissue: Minghui63 flag leaf, score: 97.137	N	N	N	N
vg0234925070	A -> G	LOC_Os02g57000.1	downstream_gene_variant ; 3334.0bp to feature; MODIFIER	silent_mutation	Average:90.827; most accessible tissue: Minghui63 flag leaf, score: 97.137	N	N	N	N
vg0234925070	A -> G	LOC_Os02g57010.1	downstream_gene_variant ; 259.0bp to feature; MODIFIER	silent_mutation	Average:90.827; most accessible tissue: Minghui63 flag leaf, score: 97.137	N	N	N	N
vg0234925070	A -> G	LOC_Os02g57010-LOC_Os02g57020	intergenic_region ; MODIFIER	silent_mutation	Average:90.827; most accessible tissue: Minghui63 flag leaf, score: 97.137	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0234925070	A	G	0.01	0.04	0.04	0.01	0.02	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0234925070	NA	2.16E-12	Grain_width	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0234925070	NA	5.01E-48	mr1125	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234925070	NA	4.33E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234925070	NA	4.59E-34	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234925070	NA	6.15E-07	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234925070	2.71E-06	NA	mr1903	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234925070	NA	2.55E-06	mr1903	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234925070	NA	1.52E-06	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234925070	NA	2.70E-63	mr1125_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234925070	NA	1.44E-07	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234925070	NA	8.46E-23	mr1386_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234925070	NA	6.19E-57	mr1526_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234925070	NA	7.35E-10	mr1526_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251