Variant ID: vg0234423363 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 34423363 |
Reference Allele: T | Alternative Allele: A |
Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 119. )
ATAAAAAAAATAAAAAAAATTGATAACATAGATTAATATTAAATATATCATTCCACAAACATGCAAGACCAAATTTAACTTCTATAAATTGCAACAAAGA[T/A]
AACAAATTAAACTGAAAATAGTTATCGCACATTCGCAACTATATCTATTATTTTTGTTATAACTTATAGAAGTTGAATTTAAACTTATGTGTTTATGGAG
CTCCATAAACACATAAGTTTAAATTCAACTTCTATAAGTTATAACAAAAATAATAGATATAGTTGCGAATGTGCGATAACTATTTTCAGTTTAATTTGTT[A/T]
TCTTTGTTGCAATTTATAGAAGTTAAATTTGGTCTTGCATGTTTGTGGAATGATATATTTAATATTAATCTATGTTATCAATTTTTTTTATTTTTTTTAT
Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 84.40% | 15.50% | 0.17% | 0.00% | NA |
All Indica | 2759 | 81.10% | 18.60% | 0.29% | 0.00% | NA |
All Japonica | 1512 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Aus | 269 | 46.10% | 53.90% | 0.00% | 0.00% | NA |
Indica I | 595 | 80.00% | 19.80% | 0.17% | 0.00% | NA |
Indica II | 465 | 91.40% | 8.40% | 0.22% | 0.00% | NA |
Indica III | 913 | 83.70% | 16.00% | 0.33% | 0.00% | NA |
Indica Intermediate | 786 | 72.90% | 26.70% | 0.38% | 0.00% | NA |
Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 46.90% | 53.10% | 0.00% | 0.00% | NA |
Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0234423363 | T -> A | LOC_Os02g56260.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.983; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0234423363 | NA | 6.55E-06 | mr1042 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0234423363 | NA | 1.10E-06 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0234423363 | NA | 4.30E-06 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0234423363 | NA | 7.91E-06 | mr1479 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0234423363 | 3.82E-06 | 1.44E-08 | mr1892 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0234423363 | NA | 2.35E-06 | mr1975 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0234423363 | NA | 9.86E-06 | mr1723_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |