Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234356928:

Variant ID: vg0234356928 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 34356928
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.08, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTATGAGCGGGGGGGTGTGGTGTTAATGGCGTGGCGTGTTGAGCTCGGCTTTCAGAGCTCAACAGTGCCAGTTTCCGTGGGAAGACATGGACATGGAT[A/G]
TATGCTGTGTCGTGTACTCGTTTACTCCCTCCGTCTCGTCTTATTAAATTTTTTTATGTAAATATAAAAAACGAAAAGTTGTACTTTAATTACTTTAGAT

Reverse complement sequence

ATCTAAAGTAATTAAAGTACAACTTTTCGTTTTTTATATTTACATAAAAAAATTTAATAAGACGAGACGGAGGGAGTAAACGAGTACACGACACAGCATA[T/C]
ATCCATGTCCATGTCTTCCCACGGAAACTGGCACTGTTGAGCTCTGAAAGCCGAGCTCAACACGCCACGCCATTAACACCACACCCCCCCGCTCATAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.40%	46.50%	0.06%	0.00%	NA
All Indica	2759	78.60%	21.30%	0.07%	0.00%	NA
All Japonica	1512	6.50%	93.50%	0.00%	0.00%	NA
Aus	269	57.20%	42.80%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	56.10%	43.90%	0.00%	0.00%	NA
Indica III	913	76.70%	23.20%	0.11%	0.00%	NA
Indica Intermediate	786	78.10%	21.80%	0.13%	0.00%	NA
Temperate Japonica	767	2.90%	97.10%	0.00%	0.00%	NA
Tropical Japonica	504	11.90%	88.10%	0.00%	0.00%	NA
Japonica Intermediate	241	7.10%	92.90%	0.00%	0.00%	NA
VI/Aromatic	96	70.80%	29.20%	0.00%	0.00%	NA
Intermediate	90	40.00%	58.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0234356928	A -> G	LOC_Os02g56140.1	upstream_gene_variant ; 141.0bp to feature; MODIFIER	silent_mutation	Average:90.368; most accessible tissue: Minghui63 panicle, score: 97.557	N	N	N	N
vg0234356928	A -> G	LOC_Os02g56160.1	upstream_gene_variant ; 4276.0bp to feature; MODIFIER	silent_mutation	Average:90.368; most accessible tissue: Minghui63 panicle, score: 97.557	N	N	N	N
vg0234356928	A -> G	LOC_Os02g56130.1	downstream_gene_variant ; 3272.0bp to feature; MODIFIER	silent_mutation	Average:90.368; most accessible tissue: Minghui63 panicle, score: 97.557	N	N	N	N
vg0234356928	A -> G	LOC_Os02g56150.1	downstream_gene_variant ; 1360.0bp to feature; MODIFIER	silent_mutation	Average:90.368; most accessible tissue: Minghui63 panicle, score: 97.557	N	N	N	N
vg0234356928	A -> G	LOC_Os02g56150.2	downstream_gene_variant ; 1360.0bp to feature; MODIFIER	silent_mutation	Average:90.368; most accessible tissue: Minghui63 panicle, score: 97.557	N	N	N	N
vg0234356928	A -> G	LOC_Os02g56140-LOC_Os02g56150	intergenic_region ; MODIFIER	silent_mutation	Average:90.368; most accessible tissue: Minghui63 panicle, score: 97.557	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0234356928	A	G	0.02	0.02	0.02	0.07	0.03	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0234356928	NA	2.44E-14	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234356928	NA	2.55E-06	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234356928	NA	5.16E-15	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234356928	NA	4.03E-06	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234356928	NA	4.94E-10	mr1829	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234356928	NA	2.18E-06	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234356928	NA	7.31E-13	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234356928	NA	2.55E-08	mr1902	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234356928	NA	1.20E-07	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234356928	NA	1.95E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234356928	9.67E-07	4.41E-15	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234356928	NA	2.13E-07	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234356928	4.06E-06	1.62E-07	mr1551_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234356928	NA	3.93E-09	mr1829_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234356928	NA	1.05E-06	mr1895_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251