Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0233999998:

Variant ID: vg0233999998 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 33999998
Reference Allele: GAlternative Allele: A,GCTGTT
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCCGTGCTTCCCCACTACGGCCGCCGTCACCGCCCTCCTCCTCTCCCGCCTCACCCCATTGACGCCCACGCACGCCCACACCTCCCCATCAACGCTCGC[G/A,GCTGTT]
CTGTTCCCGCCTCGCTGCCACCTGTCACCTCCTGTTAACGACCAAAATTGGTAGCATCGACACCTCCCTGGGCCCATCTTTGGCTGCCGCGGAACTCCGC

Reverse complement sequence

GCGGAGTTCCGCGGCAGCCAAAGATGGGCCCAGGGAGGTGTCGATGCTACCAATTTTGGTCGTTAACAGGAGGTGACAGGTGGCAGCGAGGCGGGAACAG[C/T,AACAGC]
GCGAGCGTTGATGGGGAGGTGTGGGCGTGCGTGGGCGTCAATGGGGTGAGGCGGGAGAGGAGGAGGGCGGTGACGGCGGCCGTAGTGGGGAAGCACGGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.00% 6.00% 0.99% 0.00% NA
All Indica  2759 88.20% 10.10% 1.70% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 65.40% 28.60% 6.02% 0.00% NA
Indica III  913 92.40% 6.90% 0.66% 0.00% NA
Indica Intermediate  786 87.80% 10.60% 1.65% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0233999998 G -> A LOC_Os02g55520.1 upstream_gene_variant ; 3144.0bp to feature; MODIFIER silent_mutation Average:97.948; most accessible tissue: Zhenshan97 flag leaf, score: 99.022 N N N N
vg0233999998 G -> A LOC_Os02g55530.1 upstream_gene_variant ; 671.0bp to feature; MODIFIER silent_mutation Average:97.948; most accessible tissue: Zhenshan97 flag leaf, score: 99.022 N N N N
vg0233999998 G -> A LOC_Os02g55520.2 upstream_gene_variant ; 3144.0bp to feature; MODIFIER silent_mutation Average:97.948; most accessible tissue: Zhenshan97 flag leaf, score: 99.022 N N N N
vg0233999998 G -> A LOC_Os02g55520-LOC_Os02g55530 intergenic_region ; MODIFIER silent_mutation Average:97.948; most accessible tissue: Zhenshan97 flag leaf, score: 99.022 N N N N
vg0233999998 G -> GCTGTT LOC_Os02g55520.1 upstream_gene_variant ; 3145.0bp to feature; MODIFIER N Average:97.948; most accessible tissue: Zhenshan97 flag leaf, score: 99.022 N N N N
vg0233999998 G -> GCTGTT LOC_Os02g55530.1 upstream_gene_variant ; 670.0bp to feature; MODIFIER N Average:97.948; most accessible tissue: Zhenshan97 flag leaf, score: 99.022 N N N N
vg0233999998 G -> GCTGTT LOC_Os02g55520.2 upstream_gene_variant ; 3145.0bp to feature; MODIFIER N Average:97.948; most accessible tissue: Zhenshan97 flag leaf, score: 99.022 N N N N
vg0233999998 G -> GCTGTT LOC_Os02g55520-LOC_Os02g55530 intergenic_region ; MODIFIER N Average:97.948; most accessible tissue: Zhenshan97 flag leaf, score: 99.022 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0233999998 G A 0.0 0.0 -0.01 0.01 0.01 0.01
vg0233999998 G GCTGT* -0.04 -0.05 -0.07 -0.04 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0233999998 NA 4.61E-10 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233999998 NA 9.65E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233999998 NA 7.59E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233999998 NA 2.04E-08 mr1439_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233999998 NA 2.71E-07 mr1439_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233999998 NA 2.33E-08 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233999998 NA 7.41E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233999998 NA 4.00E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251