Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0233741277:

Variant ID: vg0233741277 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 33741277
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

GTTACAATGTTACAAGCAGAGCTGAATTCAACCACAACATTAGGGAGGTTTACACCTAATATACAAGAGATACATGCACAATTCTATATCAGGCAAAAAA[A/G]
AACTGGGGAAAAAGAGGAGCACATCAACATATAGCTTCCACATAGCACGTGCACACTTACATTTCAACCTAAACAGGACCGAACCTTCAAGGGAAAAAGA

Reverse complement sequence

TCTTTTTCCCTTGAAGGTTCGGTCCTGTTTAGGTTGAAATGTAAGTGTGCACGTGCTATGTGGAAGCTATATGTTGATGTGCTCCTCTTTTTCCCCAGTT[T/C]
TTTTTTGCCTGATATAGAATTGTGCATGTATCTCTTGTATATTAGGTGTAAACCTCCCTAATGTTGTGGTTGAATTCAGCTCTGCTTGTAACATTGTAAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.90%	23.70%	0.36%	0.00%	NA
All Indica	2759	99.30%	0.70%	0.00%	0.00%	NA
All Japonica	1512	27.80%	71.20%	1.06%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.80%	0.00%	0.00%	NA
Temperate Japonica	767	9.50%	89.30%	1.17%	0.00%	NA
Tropical Japonica	504	39.30%	59.90%	0.79%	0.00%	NA
Japonica Intermediate	241	61.80%	36.90%	1.24%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	73.30%	25.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0233741277	A -> G	LOC_Os02g55080.1	upstream_gene_variant ; 3948.0bp to feature; MODIFIER	silent_mutation	Average:56.88; most accessible tissue: Callus, score: 83.906	N	N	N	N
vg0233741277	A -> G	LOC_Os02g55100.1	upstream_gene_variant ; 3715.0bp to feature; MODIFIER	silent_mutation	Average:56.88; most accessible tissue: Callus, score: 83.906	N	N	N	N
vg0233741277	A -> G	LOC_Os02g55090.1	intron_variant ; MODIFIER	silent_mutation	Average:56.88; most accessible tissue: Callus, score: 83.906	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0233741277	NA	1.25E-14	mr1276	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233741277	NA	3.69E-06	mr1657	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233741277	NA	8.08E-10	mr1690	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233741277	NA	4.29E-06	mr1782	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233741277	NA	9.38E-06	mr1890	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233741277	9.22E-07	NA	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233741277	NA	3.26E-06	mr1695_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233741277	NA	3.15E-09	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251