Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0233645466:

Variant ID: vg0233645466 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 33645466
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACGGACAAATATAAGGTGAAAAGATACAATCCGTATTCTTTAAGTATATGTAAAGAAAAGATATAGGTAAAGATAAAATTAAAAAACAAACTCTAATAC[T/C]
AGAATCTTGACAAAAACATATTTAATTTTTATATATAATAGTAGGGATAGGGATATAGTAGAGATAGAGATACAAGGCGAAGAAGAAAAGATACGGACCT

Reverse complement sequence

AGGTCCGTATCTTTTCTTCTTCGCCTTGTATCTCTATCTCTACTATATCCCTATCCCTACTATTATATATAAAAATTAAATATGTTTTTGTCAAGATTCT[A/G]
GTATTAGAGTTTGTTTTTTAATTTTATCTTTACCTATATCTTTTCTTTACATATACTTAAAGAATACGGATTGTATCTTTTCACCTTATATTTGTCCGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.50% 31.50% 0.93% 0.00% NA
All Indica  2759 98.90% 0.90% 0.11% 0.00% NA
All Japonica  1512 8.50% 88.90% 2.58% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.00% 0.25% 0.00% NA
Temperate Japonica  767 12.60% 82.90% 4.43% 0.00% NA
Tropical Japonica  504 0.40% 99.20% 0.40% 0.00% NA
Japonica Intermediate  241 12.40% 86.30% 1.24% 0.00% NA
VI/Aromatic  96 18.80% 81.20% 0.00% 0.00% NA
Intermediate  90 54.40% 43.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0233645466 T -> C LOC_Os02g54930.1 downstream_gene_variant ; 1158.0bp to feature; MODIFIER silent_mutation Average:66.644; most accessible tissue: Callus, score: 92.783 N N N N
vg0233645466 T -> C LOC_Os02g54930-LOC_Os02g54940 intergenic_region ; MODIFIER silent_mutation Average:66.644; most accessible tissue: Callus, score: 92.783 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0233645466 NA 6.69E-26 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233645466 NA 7.40E-14 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233645466 NA 1.94E-45 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233645466 7.73E-06 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233645466 NA 1.37E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233645466 8.65E-06 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233645466 NA 1.81E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233645466 NA 1.50E-16 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233645466 NA 6.56E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233645466 NA 2.44E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233645466 4.61E-08 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233645466 9.41E-07 1.20E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233645466 NA 1.68E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233645466 6.65E-06 NA mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233645466 NA 7.43E-22 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233645466 NA 4.92E-11 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233645466 1.07E-06 2.39E-34 mr1922 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233645466 NA 1.04E-06 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233645466 NA 1.37E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233645466 NA 1.07E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233645466 NA 7.46E-17 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233645466 NA 4.70E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233645466 NA 4.69E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251