Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0231850031:

Variant ID: vg0231850031 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 31850031
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCACGCACCAACAAACGCCAGCTGCCTTGCCATTTCGTCTCGGCTCCGGCGGAGCTGAGCTAGCTGGCCTGCACGGAAGTGGACCAACAAAAGCGCCG[C/T]
TCCCGTGGTCCATCGTGACGCGCCTAGATATGATACCAGCGAAAGGGCAACGCGGGCAGGCACGAATGAATGCGCGATCCGTCCGTTCGCAATTCACCGC

Reverse complement sequence

GCGGTGAATTGCGAACGGACGGATCGCGCATTCATTCGTGCCTGCCCGCGTTGCCCTTTCGCTGGTATCATATCTAGGCGCGTCACGATGGACCACGGGA[G/A]
CGGCGCTTTTGTTGGTCCACTTCCGTGCAGGCCAGCTAGCTCAGCTCCGCCGGAGCCGAGACGAAATGGCAAGGCAGCTGGCGTTTGTTGGTGCGTGCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.40% 49.20% 0.17% 0.30% NA
All Indica  2759 18.20% 81.20% 0.25% 0.40% NA
All Japonica  1512 99.70% 0.30% 0.07% 0.00% NA
Aus  269 77.70% 21.90% 0.00% 0.37% NA
Indica I  595 1.20% 98.50% 0.17% 0.17% NA
Indica II  465 34.60% 64.30% 0.65% 0.43% NA
Indica III  913 11.20% 88.20% 0.11% 0.55% NA
Indica Intermediate  786 29.50% 69.80% 0.25% 0.38% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 75.60% 22.20% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0231850031 C -> T LOC_Os02g52030.1 upstream_gene_variant ; 420.0bp to feature; MODIFIER silent_mutation Average:97.043; most accessible tissue: Zhenshan97 flower, score: 99.765 N N N N
vg0231850031 C -> T LOC_Os02g52040.1 upstream_gene_variant ; 1325.0bp to feature; MODIFIER silent_mutation Average:97.043; most accessible tissue: Zhenshan97 flower, score: 99.765 N N N N
vg0231850031 C -> T LOC_Os02g52050.1 upstream_gene_variant ; 4349.0bp to feature; MODIFIER silent_mutation Average:97.043; most accessible tissue: Zhenshan97 flower, score: 99.765 N N N N
vg0231850031 C -> T LOC_Os02g52020.1 downstream_gene_variant ; 3053.0bp to feature; MODIFIER silent_mutation Average:97.043; most accessible tissue: Zhenshan97 flower, score: 99.765 N N N N
vg0231850031 C -> T LOC_Os02g52020-LOC_Os02g52030 intergenic_region ; MODIFIER silent_mutation Average:97.043; most accessible tissue: Zhenshan97 flower, score: 99.765 N N N N
vg0231850031 C -> DEL N N silent_mutation Average:97.043; most accessible tissue: Zhenshan97 flower, score: 99.765 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0231850031 C T 0.0 -0.04 -0.03 0.0 0.01 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0231850031 NA 7.09E-08 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0231850031 NA 4.53E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231850031 NA 4.69E-09 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231850031 NA 1.81E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231850031 NA 3.47E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231850031 NA 1.54E-07 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231850031 NA 6.42E-09 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231850031 NA 4.30E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231850031 NA 1.65E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231850031 NA 2.73E-08 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231850031 NA 7.34E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231850031 NA 1.21E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231850031 NA 3.15E-12 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231850031 NA 4.93E-08 mr1722_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231850031 NA 4.53E-11 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231850031 NA 1.11E-13 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231850031 NA 2.23E-19 mr1904_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231850031 NA 9.44E-09 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231850031 NA 1.42E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251