Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0231595768:

Variant ID: vg0231595768 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 31595768
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

GTGGGCGGCGCAGCATGGGGATGGCGCGGTGTGGTGCGGTTTCTTTCTTTCGCAGTGATTCTTTTTTTCGTGCGCTGTGCGGTTTCTTTCTTAGGGATGA[C/T]
AAGTGGGACCCACGTGAGAGTGGGTCTAAAAGATTGCGGGATTGGTAATGAACTGGTACTTTTTATATTAGTAGATTAGTATAGAGTATAGATATAGATT

Reverse complement sequence

AATCTATATCTATACTCTATACTAATCTACTAATATAAAAAGTACCAGTTCATTACCAATCCCGCAATCTTTTAGACCCACTCTCACGTGGGTCCCACTT[G/A]
TCATCCCTAAGAAAGAAACCGCACAGCGCACGAAAAAAAGAATCACTGCGAAAGAAAGAAACCGCACCACACCGCGCCATCCCCATGCTGCGCCGCCCAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.20%	12.70%	0.02%	0.06%	NA
All Indica	2759	85.00%	14.90%	0.04%	0.11%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	36.80%	63.20%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	64.90%	34.20%	0.22%	0.65%	NA
Indica III	913	94.90%	5.10%	0.00%	0.00%	NA
Indica Intermediate	786	74.30%	25.70%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0231595768	C -> T	LOC_Os02g51580.1	upstream_gene_variant ; 642.0bp to feature; MODIFIER	silent_mutation	Average:64.9; most accessible tissue: Minghui63 root, score: 80.565	N	N	N	N
vg0231595768	C -> T	LOC_Os02g51590.1	upstream_gene_variant ; 1856.0bp to feature; MODIFIER	silent_mutation	Average:64.9; most accessible tissue: Minghui63 root, score: 80.565	N	N	N	N
vg0231595768	C -> T	LOC_Os02g51570.1	downstream_gene_variant ; 2616.0bp to feature; MODIFIER	silent_mutation	Average:64.9; most accessible tissue: Minghui63 root, score: 80.565	N	N	N	N
vg0231595768	C -> T	LOC_Os02g51580-LOC_Os02g51590	intergenic_region ; MODIFIER	silent_mutation	Average:64.9; most accessible tissue: Minghui63 root, score: 80.565	N	N	N	N
vg0231595768	C -> DEL	N	N	silent_mutation	Average:64.9; most accessible tissue: Minghui63 root, score: 80.565	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0231595768	NA	1.54E-07	mr1383_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231595768	NA	3.78E-06	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231595768	NA	8.50E-07	mr1712_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231595768	2.47E-07	1.14E-08	mr1717_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231595768	NA	4.86E-08	mr1722_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231595768	NA	6.93E-06	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231595768	NA	1.52E-06	mr1910_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231595768	NA	6.43E-07	mr1946_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231595768	NA	6.43E-07	mr1948_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251