Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0231289965:

Variant ID: vg0231289965 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 31289965
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

GATGAATGAATGAATGATCATTGTTTTGGGCAAGAAAACACCGTTCCGGCCGGATTGACGAGGAACCCATATCGATCCGCTCGCCGTGGCCCATGGAAAC[C/T]
CAACAGGAGATGGCGGCGCTACCTTCCGCTGCCGGCGACTACTAATGGTGGGTGATGCTCGAGCACATTGACGAACTCGAGGTCGACGACGAGGACTCCA

Reverse complement sequence

TGGAGTCCTCGTCGTCGACCTCGAGTTCGTCAATGTGCTCGAGCATCACCCACCATTAGTAGTCGCCGGCAGCGGAAGGTAGCGCCGCCATCTCCTGTTG[G/A]
GTTTCCATGGGCCACGGCGAGCGGATCGATATGGGTTCCTCGTCAATCCGGCCGGAACGGTGTTTTCTTGCCCAAAACAATGATCATTCATTCATTCATC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.20%	7.70%	1.12%	0.00%	NA
All Indica	2759	85.10%	13.00%	1.81%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	99.00%	0.00%	1.01%	0.00%	NA
Indica II	465	66.20%	29.90%	3.87%	0.00%	NA
Indica III	913	87.50%	12.20%	0.33%	0.00%	NA
Indica Intermediate	786	83.10%	14.00%	2.93%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	4.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0231289965	C -> T	LOC_Os02g51140.1	upstream_gene_variant ; 701.0bp to feature; MODIFIER	silent_mutation	Average:60.245; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N
vg0231289965	C -> T	LOC_Os02g51140.2	upstream_gene_variant ; 701.0bp to feature; MODIFIER	silent_mutation	Average:60.245; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N
vg0231289965	C -> T	LOC_Os02g51130.1	downstream_gene_variant ; 3224.0bp to feature; MODIFIER	silent_mutation	Average:60.245; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N
vg0231289965	C -> T	LOC_Os02g51130-LOC_Os02g51140	intergenic_region ; MODIFIER	silent_mutation	Average:60.245; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0231289965	NA	2.71E-06	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231289965	NA	1.93E-06	mr1701	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231289965	NA	7.32E-06	mr1260_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231289965	NA	8.34E-09	mr1319_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231289965	NA	6.45E-06	mr1319_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231289965	NA	1.51E-06	mr1330_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231289965	1.16E-06	1.29E-07	mr1442_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231289965	4.84E-06	9.69E-07	mr1442_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251