Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230936995:

Variant ID: vg0230936995 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 30936995
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


ACCAAACTAGCTCTATATTACAATACTTTGTCTCCGATCCACTATGGTTATAGCAGCCACTATTAGAGTTAGTACAAACGCTATTTATTATCTGGTTTAT[A/T]
ACACACCCTAACATCACCACTAGAATTGGATATTTAACCAAAGGTTCAAGGGGCGTCGAGGAGCAATTATTTGTAAAATTCATGCGTAGTTCACGTGAAG

Reverse complement sequence

CTTCACGTGAACTACGCATGAATTTTACAAATAATTGCTCCTCGACGCCCCTTGAACCTTTGGTTAAATATCCAATTCTAGTGGTGATGTTAGGGTGTGT[T/A]
ATAAACCAGATAATAAATAGCGTTTGTACTAACTCTAATAGTGGCTGCTATAACCATAGTGGATCGGAGACAAAGTATTGTAATATAGAGCTAGTTTGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.80% 29.80% 0.32% 0.00% NA
All Indica  2759 48.90% 50.60% 0.51% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 12.80% 86.90% 0.34% 0.00% NA
Indica II  465 74.80% 24.70% 0.43% 0.00% NA
Indica III  913 49.90% 49.30% 0.77% 0.00% NA
Indica Intermediate  786 59.80% 39.80% 0.38% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 86.70% 12.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0230936995 A -> T LOC_Os02g50640.1 upstream_gene_variant ; 2704.0bp to feature; MODIFIER silent_mutation Average:71.209; most accessible tissue: Callus, score: 91.862 N N N N
vg0230936995 A -> T LOC_Os02g50650.1 downstream_gene_variant ; 3363.0bp to feature; MODIFIER silent_mutation Average:71.209; most accessible tissue: Callus, score: 91.862 N N N N
vg0230936995 A -> T LOC_Os02g50640-LOC_Os02g50650 intergenic_region ; MODIFIER silent_mutation Average:71.209; most accessible tissue: Callus, score: 91.862 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0230936995 A T 0.01 0.0 0.0 0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0230936995 NA 8.36E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230936995 NA 7.79E-14 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230936995 NA 1.12E-10 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230936995 NA 5.68E-08 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230936995 NA 4.64E-22 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230936995 NA 4.71E-07 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230936995 NA 6.49E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230936995 NA 7.65E-09 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230936995 NA 3.92E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230936995 NA 5.80E-07 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230936995 NA 1.16E-07 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230936995 NA 3.59E-06 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230936995 NA 2.14E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230936995 NA 2.89E-26 mr1531_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230936995 NA 1.49E-11 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230936995 NA 7.61E-34 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230936995 NA 3.46E-14 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230936995 NA 2.21E-09 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230936995 NA 1.61E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251