Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230504954:

Variant ID: vg0230504954 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 30504954
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAGAGCCTAGATTATTGGGTTTGCAAGTCTAAAAAGGGAGTGGGGTGGCATGGTGGGTAATTTTTCACCCAATAATCTAGAAAAAGCTCACCTAAATAA[G/T]
CTTATCAGATTATAATAAGTTGGGCTCCAGATTATAATAAGCTACTTCAATAAGTTGTCTGTTTCTTTCAGCTTACTTCTAATAATCTAGATTATAATAA

Reverse complement sequence

TTATTATAATCTAGATTATTAGAAGTAAGCTGAAAGAAACAGACAACTTATTGAAGTAGCTTATTATAATCTGGAGCCCAACTTATTATAATCTGATAAG[C/A]
TTATTTAGGTGAGCTTTTTCTAGATTATTGGGTGAAAAATTACCCACCATGCCACCCCACTCCCTTTTTAGACTTGCAAACCCAATAATCTAGGCTCTAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.70%	6.30%	0.00%	0.00%	NA
All Indica	2759	95.10%	4.90%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	42.80%	57.20%	0.00%	0.00%	NA
Indica I	595	96.50%	3.50%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	97.80%	2.20%	0.00%	0.00%	NA
Indica Intermediate	786	88.50%	11.50%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0230504954	G -> T	LOC_Os02g49930.1	upstream_gene_variant ; 2142.0bp to feature; MODIFIER	silent_mutation	Average:80.734; most accessible tissue: Callus, score: 96.814	N	N	N	N
vg0230504954	G -> T	LOC_Os02g49920.1	downstream_gene_variant ; 2665.0bp to feature; MODIFIER	silent_mutation	Average:80.734; most accessible tissue: Callus, score: 96.814	N	N	N	N
vg0230504954	G -> T	LOC_Os02g49920-LOC_Os02g49930	intergenic_region ; MODIFIER	silent_mutation	Average:80.734; most accessible tissue: Callus, score: 96.814	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0230504954	G	T	0.02	0.01	0.0	-0.01	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0230504954	NA	1.77E-06	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230504954	NA	2.26E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230504954	NA	2.33E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230504954	NA	2.77E-06	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230504954	NA	3.59E-06	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230504954	NA	6.55E-06	mr1353	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230504954	NA	8.26E-08	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230504954	6.09E-06	6.07E-06	mr1421	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230504954	NA	8.76E-06	mr1438	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230504954	4.18E-06	4.18E-06	mr1459	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230504954	NA	3.30E-07	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230504954	NA	8.47E-07	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230504954	NA	2.39E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230504954	NA	4.94E-10	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230504954	NA	2.79E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251