RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0230277888:

Variant ID: vg0230277888 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 30277888
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, G: 0.06, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

AGTAAATTTCACAAAACTACAGGTATTTTGACCAAATTATCACAAAACTACAGATTTAAGGAGTTGTATCACAAAACTACACATTTAGCACCAAATTTAT[C/G]
ACAAAACTACATATTTTAGGTTAAGTATCACAAAAATGCATATTTAATATTGAACTTATCACAAAACTACAACTTTTAGAGTTTAAATCCTAGCACTATT

Reverse complement sequence

AATAGTGCTAGGATTTAAACTCTAAAAGTTGTAGTTTTGTGATAAGTTCAATATTAAATATGCATTTTTGTGATACTTAACCTAAAATATGTAGTTTTGT[G/C]
ATAAATTTGGTGCTAAATGTGTAGTTTTGTGATACAACTCCTTAAATCTGTAGTTTTGTGATAATTTGGTCAAAATACCTGTAGTTTTGTGAAATTTACT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.10%	36.90%	0.00%	0.00%	NA
All Indica	2759	97.90%	2.10%	0.00%	0.00%	NA
All Japonica	1512	0.90%	99.10%	0.00%	0.00%	NA
Aus	269	86.20%	13.80%	0.00%	0.00%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	96.30%	3.70%	0.00%	0.00%	NA
Indica III	913	98.90%	1.10%	0.00%	0.00%	NA
Indica Intermediate	786	96.70%	3.30%	0.00%	0.00%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	1.40%	98.60%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	34.40%	65.60%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0230277888	C -> G	LOC_Os02g49550.1	upstream_gene_variant ; 4470.0bp to feature; MODIFIER	silent_mutation	Average:41.196; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0230277888	C -> G	LOC_Os02g49540.1	downstream_gene_variant ; 3413.0bp to feature; MODIFIER	silent_mutation	Average:41.196; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0230277888	C -> G	LOC_Os02g49530.1	intron_variant ; MODIFIER	silent_mutation	Average:41.196; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0230277888	C -> G	LOC_Os02g49530.2	intron_variant ; MODIFIER	silent_mutation	Average:41.196; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0230277888	5.64E-08	NA	Awn_length	Ind_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0230277888	NA	1.18E-08	mr1050	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230277888	NA	1.57E-10	mr1272	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230277888	NA	1.89E-23	mr1571	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230277888	NA	1.72E-10	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 5 of 5 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0230277888:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact