Variant ID: vg0230189175 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 30189175 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 350. )
AGTGAAGTTAACAAGAACGCGAACATGAACTTAACGTACGTTAACGTGAATGCACGTGAACGAACGAACGTAGGTGAACGAAACATGAACTTAACGAGAA[C/T]
GCGAACGTGAATGATCGTGAACGAAATGTGAACTTAACAAGAACGCGAACGTGAAATACAATATATGTTACTTTGCGTTTATCCTAATACATCTTTTTGT
ACAAAAAGATGTATTAGGATAAACGCAAAGTAACATATATTGTATTTCACGTTCGCGTTCTTGTTAAGTTCACATTTCGTTCACGATCATTCACGTTCGC[G/A]
TTCTCGTTAAGTTCATGTTTCGTTCACCTACGTTCGTTCGTTCACGTGCATTCACGTTAACGTACGTTAAGTTCATGTTCGCGTTCTTGTTAACTTCACT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 93.00% | 6.30% | 0.70% | 0.00% | NA |
All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 80.10% | 17.70% | 2.18% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 93.50% | 4.30% | 2.22% | 0.00% | NA |
Tropical Japonica | 504 | 69.60% | 29.40% | 0.99% | 0.00% | NA |
Japonica Intermediate | 241 | 59.30% | 36.10% | 4.56% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0230189175 | C -> T | LOC_Os02g49410.1 | downstream_gene_variant ; 2296.0bp to feature; MODIFIER | silent_mutation | Average:25.34; most accessible tissue: Zhenshan97 flower, score: 38.669 | N | N | N | N |
vg0230189175 | C -> T | LOC_Os02g49400.1 | intron_variant ; MODIFIER | silent_mutation | Average:25.34; most accessible tissue: Zhenshan97 flower, score: 38.669 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0230189175 | 1.11E-07 | NA | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0230189175 | 6.49E-06 | NA | mr1949 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0230189175 | 1.32E-06 | NA | mr1070_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0230189175 | NA | 2.48E-06 | mr1070_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0230189175 | 8.99E-07 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0230189175 | 4.59E-07 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0230189175 | 8.51E-08 | NA | mr1085_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0230189175 | NA | 4.53E-06 | mr1085_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0230189175 | 3.74E-06 | NA | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0230189175 | 2.37E-10 | NA | mr1104_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/